Virosis en zapallito de tronco

Las principales virosis que afectan al zapallito redondo son las producidas por virus del género Potyvirus. Hay 4 especies de este grupo presentes en Argentina, estos son: Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), y Papaya ringspot virus (PRSV) y Cucumber vein banding virus (CVBV). Las tres primeras son comunes y las más abundantes en todas las regiones productoras de zapallo en el mundo. La última especie hasta el momento solo se ha mencionado y detectado en el país. También se han detectado virosis producidas por especies de otro género, Orthotospovirus, que son los que comúnmente denominamos tospovirus, se han detectado una especie en sandía y otra en zapallito redondo.Instituto de Patología VegetalFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; ArgentinaFil: Perotto, Maria Cecilia. Consejo Nacional de Investigaciones Científicas y Técnicas. Unidad de Fitopatología y Modelización Agrícola (UFyMA); Argentin

Spatial regression models over two-dimensional manifolds

We propose a regression model for data spatially distributed over general two-dimensional Riemannian manifolds. This is a generalized additive model with a roughness penalty term involving a differential operator computed over the non-planar domain. By virtue of a semiparametric framework, the model allows inclusion of space-varying covariate information. Estimation can be performed by conformally parameterizing the non-planar domain and then generalizing existing models for penalized spatial regression over planar domains. The conformal coordinates and the estimation problem are both computed with a finite element approach

415 Correlation between tissue abnormalities and myocardial deformation indices in arrhythmogenic cardiomyopathy: a pilot study

Abstract Aims To evaluate the correlation between cardiac magnetic resonance (CMR) tissue abnormalities and impairment of myocardial deformation indices in patients with definite diagnosis of arrhythmogenic cardiomyopathy (AC). Methods and results 41 AC Patients with available CMR study were enrolled. Myocardial deformation indices (i.e. global longitudinal strain -GLS-; global circumferential strain -GCS-; global radial strain -GRS-) for both ventricles were calculated using feature tracking analysis. Quantification of tissue abnormalities (i.e. late gadolinium enhancement -LGE- extension expressed as percentage of total ventricular mass) was performed. Spearman's rho correlation was evaluated. Mean age was 44 ± 13 years and 26 (63%) patients were male. Mean left ventricular (LV) ejection fraction (EF) was 54 ± 10% and mean right ventricular (RV) EF was 49 ± 12%. Median LV LGE extension was 8.9% (1.05–21) and median RV LGE extension was 0 (0–6.92). All myocardial deformation indices were moderately associated with LGE extension (for LV 3D GLS Spearman's Rho 0.423, P 0.016; 2D GCS Spearman's Rho 0.388, P 0.028; 3D GCS 0.362, P 0.042; 2D GRS Spearman's Rho −0.417, P 0.018; 3D GRS −0.396, P 0.025; for RV 2D GLS Spearman's Rho 0.385, P 0.030; RV GCS Spearman's Rho 0.450, P 0.010; RV GRS Spearman's Rho −0.459, P 0.008). Conclusions All myocardial deformation indices showed a moderate association with LGE extension in a cohort of patients with definite AC. Further studies are needed to validate this observation and understand its implications

First report of Strawberry crinkle virus in Argentina

Strawberry crinkle virus (SCV) is one of the most frequent viruses affecting strawberry worldwide, and responsible for important reductions in yield and fruit quality. Stunted dwarfed plants with distorted leaves were found in Lules (26°55′22″S 65°20′15″W), Tucumán province, Argentina, in 2010, suggesting the virus presence. Total nucleic acids were isolated from leaves of 26 strawberry plants (Fragaria x ananassa cv. Camarosa) showing symptoms using the modified cetyltrimethylammonium bromide method (CTAB) as performed by Chang et al. (2007). Healthy strawberry plants previously tested by grafting to indicator plants (Fragaria virginiana clone UC-12, F. vesca clone UC-6 and cv. Alpine) were used as negative controls.Fil: Perotto, Maria Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Luciani, Carlos. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Fondo para la Investigación Científica y Tecnológica; ArgentinaFil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Torrico Ramallo, Ada Karina. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; ArgentinaFil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentin

Occurrence and characterization of a severe isolate of Watermelon mosaic virus from Argentina

More than 50 viruses have been reported in cucurbit crops worldwide. In Argentina, cucurbit viruses have been associated with important yield losses. The most prevalent and widespread potyvirus is Watermelon mosaic virus (WMV). WMV was detected in Argentina in all cucurbit species with high incidence. In this study, a WMV isolate (WMV 1 SDE FF) was obtained from a naturally infected squash associated with a severe outbreak on melon and squash crops in an important cucurbit growing area in Santiago del Estero province (Argentina), during a survey conducted in November 2012. The fully sequenced WMV 1 SDE FF genome consists of 10,027 nucleotides and shares 96 % nt identity and 98 % aa identity with the French isolates JF273464.1|C07–014 and EU660581.1|FMF00-LL1 of the WMV molecular group 3. Using the recombination detection program RDP4, two statistically significant recombination events were identified: event 1, an 830-nt long recombinant fragment in the putative P1 coding region, and event 2, a 4071-nt recombinant fragment detected across the HC Pro, P3 and CI coding regions. The putative parental sequences detected for event 1 were the EU660586.1| FBR04–37 (major parent) and JF273468.1|C07–284 (minor parent), both from France. Putative parental sequences for event 2 were JX079685.1| WMV-ShanXi (major parent) and HQ384216.1|Dendrobium (minor parent), from China and USA, respectively. To our knowledge, this is the first complete genome of an Argentine WMV isolate. Our results provide evidence that WMV 1 SDE FF is the causal agent of the strong outbreak reported in melon and squash fields in recent years.Inst. Patología VegetalFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Celli, Marcos Giovani. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Pozzi, Elizabeth Alicia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Luciani, Cecilia E. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Conci, Vilma Cecilia. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Patología Vegetal; Argentina. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentin

First report of Zucchini lethal chlorosis virus in Argentina infecting squash crops

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de São Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. ?cayote?, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.Fil: Pozzi, Elizabeth Alicia. Consejo Nacional de Investigaciones Científicas y Técnicas; Argentina. Instituto Nacional de Tecnologia Agropecuaria. Centro Regional Cordoba. Estacion Experimental Agropecuaria Marcos Juarez. Agencia de Extension Rural Bell Ville.; ArgentinaFil: Luciani, Cecilia Elizabeth. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Giovani Celli, Marcos Giovani. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Conci, Vilma Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; ArgentinaFil: Perotto, Maria Cecilia. Instituto Nacional de Tecnologia Agropecuaria. Centro de Investigaciones Agropecuarias. Unidad de Fitopatologia y Modelizacion Agricola. - Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Cordoba. Unidad de Fitopatologia y Modelizacion Agricola.; Argentin

Abnormal conduction-induced cardiomyopathy: a poorly explored entity

A dyssynchronous biventricular activation, which can be determined by left bundle branch block, chronic right ventricular pacing, frequent premature ventricular complexes, or pre-excitation, can cause a global abnormal contractility, thus leading to systolic dysfunction and left ventricular remodelling in a unique nosological entities: abnormal conduction-induced cardiomyopathies. In this clinical scenario, the mainstay therapy is eliminating or improving LV dyssynchrony, removing the trigger. This usually ensures the improvement and even recovery of cardiac geometry and left ventricular function, especially in the absence of genetic background. A multidisciplinary approach, integrating advanced multimodal imaging, is essential for the systematic aetiological definition and the subsequent evaluation and aetiology-guided therapies of patients and their families. This review aims to describe mechanisms, prevalence, risk factors, and diagnostic and therapeutic approach to the various abnormal conduction-induced cardiomyopathies, starting from reasonable certainties and then analysing the grey areas requiring further studies

Hi-POD solution of parametrized fluid dynamics problems: preliminary results

Numerical modeling of fluids in pipes or network of pipes (like in the circulatory system) has been recently faced with new methods that exploit the specific nature of the dynamics, so that a one dimensional axial mainstream is enriched by local secondary transverse components [4, 16, 18]. These methods - under the name of Hi-Mod approximation - construct a solution as a finite element axial discretization, completed by a spectral approximation of the transverse dynamics. It has been demonstrated that Hi-Mod reduction significantly accelerates the computations without com- promising the accuracy. In view of variational data assimilation procedures (or, more in general, control problems), it is crucial to have efficient model reduction techniques to rapidly solve, for instance, a parametrized problem for several choices of the parameters of interest. In this work, we present some preliminary results merging Hi-Mod techniques with a classical Proper Orthogonal Decomposition (POD) strategy. We name this new approach as Hi-POD model reduction. We demonstrate the efficiency and the reliability of Hi-POD on multiparameter advection-diffusion-reaction problems as well as on the incompressible Navier-Stokes equations, both in a steady and in an unsteady setting

Association of Tricuspid Regurgitation With Outcome in Acute Heart Failure

Background: Tricuspid regurgitation (TR) is common in chronic heart failure (HF) and is associated with negative prognosis. However, evidence on prognostic implications of TR in acute HF is lacking. We sought to investigate the association between TR and mortality and the interaction with pulmonary hypertension (PH) in patients admitted for acute HF. Methods: We enrolled 1176 consecutive patients with a primary diagnosis of acute HF and with available noninvasive estimation of TR and pulmonary arterial systolic pressure. Results: Moderate-severe TR was present in 352 patients (29.9%) and was associated with older age and more comorbidities. The prevalence of PH (ie, pulmonary arterial systolic pressure >40 mm Hg), right ventricular dysfunction, and mitral regurgitation was higher in moderate-severe TR. At 1 year, 184 (15.6%) patients died. Moderate-severe TR was associated with higher 1-year mortality risk after adjustment for other echocardiographic parameters (pulmonary arterial systolic pressure, left ventricle ejection fraction, right ventricular dysfunction, mitral regurgitation, left and right atrial indexed volumes; hazard ratio, 1.718; P=0.009), and the association with outcome was maintained when clinical variables (eg, natriuretic peptides, serum creatinine and urea, systolic blood pressure, atrial fibrillation) were added to the multivariable model (hazard ratio, 1.761; P=0.024). The association between moderate-severe TR and outcome was consistent in patients with versus without PH, with versus without right ventricular dysfunction, and with versus without left ventricle ejection fraction <50%. Patients with coexistent moderate-severe TR and PH had 3-fold higher 1-year mortality risk compared with patients with no TR or PH (hazard ratio, 3.024; P<0.001). Conclusions: In patients hospitalized for acute HF, the severity of TR is associated with 1-year survival, regardless of the presence of PH. The coexistence of moderate-severe TR and estimated PH was associated with a further increase in mortality risk. Our data must be interpreted in the context of potential underestimation of pulmonary arterial systolic pressure in patients with severe TR