Changes in growth, survival and digestive enzyme activities of Asian redtail catfish, Mystus nemurus, larvae fed on different diets

A study was conducted to determine the effects of different dietary treatments on the growth, survival and digestive enzyme activities of Mystus nemurus larvae. Newly hatched larvae were reared for 14 days in twelve 15 L glass aquaria (for growth and survival) and eight 300 L fiberglass tanks (for enzyme samples) at a stocking density of 15 larvae L-1. Beginning at 2 days, the larvae were randomly assigned to Artemia nauplii, a microbound diet and a 50:50 combination of live food-microbound diet, while another group was unfed. All treatments were triplicated (growth and survival) or duplicated (enzyme development). The results showed that, M. nemurus larvae which fed on Artemia nauplii gave the highest survival rate (83.7%), followed by those fed on a combination diet (56.0%) and a microbound diet (26.5%). All unfed larvae did not survive beyond Day 9. Artemia had also given the best growth (20.4 ± 1.4 mm TL and 37.2 ± 6.0 mg wet weight) for the catfish larvae. This was followed by the combination diet (18.3 ± 0.6 mm TL and 32.6 ± 3.4 mg wet weight) and the microbound diet (11.0 ± 0.1 mm TL and 11.9 ± 0.9 mg wet weight), respectively. Pepsin began to significantly appear in M. nemurus larvae at 4 days old for all treatments, while chymotrypsin, trypsin and amylase were present even in the newly hatched larvae. In general, highest enzyme activities were observed among larvae which fed on a combination diet, followed by those fed on live and artificial diets, respectively. This suggested the important role of exogenous enzymes from live food in the larval digestion particularly at the early feeding stages.Key words: Mystus nemurus, Artemia nauplii, larvae, microbound diet, combination diet

GENE EDITING IN PIGS

Genetically modified animals, especially rodents, are widely used in biomedical research. However, non-rodent models are required for efficient translational medicine and preclinical studies. Owing to the similarity in the physiological traits of pigs and humans, genetically modified pigs may be a valuable resource for biomedical research. Somatic cell nuclear transfer (SCNT) using genetically modified somatic cells has been the primary method for the generation of genetically modified pigs. However, site-specific gene modification in porcine cells is inefficient and requires laborious and time-consuming processes. Recent improvements in gene-editing systems, such as zinc finger nucleases, transcription activator-like effector nucleases, and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (CRISPR/Cas) system, represent major advances. The efficient introduction of site-specific modifications into cells via gene editors dramatically reduces the effort and time required to generate genetically modified pigs. Furthermore, gene editors enable direct gene modification during embryogenesis, bypassing the SCNT procedure. The application of gene editors has progressively expanded, and a range of strategies is now available for porcine gene engineering. This review provides an overview of approaches for the generation of genetically modified pigs using gene editors, and highlights the current trends, as well as the limitations, of gene editing in pigs

Efficacy of Abdominal Ultrasonography for Differentiation of Gastrointestinal Diseases in Calves

Gastrointestinal diseases represent one of the common causes of bovine acute abdomen, such as abdominal distention, abdominal pain, and cessation of defecation. In addition to the observable signs when performing routine auscultation, rectal palpation, and biochemical examinations of ruminal fluid and blood, these clinical observations can provide evidence suggestive of these diseases, but they generally result in an inconclusive diagnosis. Therefore, exploratory laparotomy is often used because it facilitates both diagnosis and therapeutic decisions. For bovines, abdominal ultrasonography is frequently utilized as a convenient imaging modality to assist accurate diagnosis and contribute to subsequent appropriate therapeutic choices for bovine gastrointestinal diseases. According to recent trends in human medicine and small animal practice, technical improvements have led to developments in the diagnostic value of abdominal ultrasonography, including scanning methods and the establishment of valuable diagnostic signs specific to a particular disease, e.g., a target sign for intussusception.This study investigated the clinical efficacy of abdominal ultrasonography for abomasal dilation in three calves, intestinal volvulus in five calves, intussusception in one calf, and internal hernia in one calf. In the abdominal ultrasonograms of the abomasal dilation cases, this disease was commonly characterized by severely extended lumens, including heterogeneously hyperechoic ingesta without intraluminal accumulations of gas. In the animals with intestinal volvulus and intussusception, a to-and-fro flow was observed to be a common ultrasonographic characteristic that led to suspicion of an intestinal obstruction. The use of abdominal ultrasonography for five cases with intestinal volvulus gave no reason to suspect this disease, despite its efficacy in one case, based on an acutely angled narrowing. Although three of five animals with intestinal volvulus had intestinal ruptures, no ultrasonographic evidence could be obtained. When abdominal ultrasonography was used for one case with intussusception, this pathological condition could be strongly suspected, as a “target” sign was observed. This finding supported surgical intervention for this case, followed by treatment with manual reduction, resulting in a favorable outcome. In terms of the differential and definitive diagnosis for various intestinal diseases, abdominal ultrasonography may be poor at providing indicative evidence, but very helpful for confirming intestinal obstruction

Dimethyl sulfoxide-free cryopreservation solution containing trehalose, dextran 40, and propylene glycol for therapy with human adipose tissue-derived mesenchymal stromal cells

We evaluated a dimethyl sulfoxide (Me2SO)-free cryopreservation solution to freeze human adipose-derived mesenchymal stromal cells (hADSCs). In the first experiment, we compared the combined effects of 3% trehalose (3 T) and 5% dextran (5D) in lactated Ringer’s solution (LR) as a cryopreservation base solution containing 10% propylene glycol (PG). The cell viability of hADSCs immediately after thawing was significantly higher (p < 0.05) in LR supplemented with 3 T (LR-3 T) and with 3 T and 5D (LR-3 T-5D) than in LR. In the second experiment, we compared the cell characteristics of hADSCs freeze-thawed in LR-3 T-5D containing either 10% Me2SO or 10% PG. The cell viability, annexin V-positive ratio, colony-forming capacity, cell proliferation, cell surface antigen positivity, adipogenic differentiation, osteogenic differentiation, and genetic response to cytokine stimulation of hADSCs immediately after thawing were similar between the LR-3 T-5D containing 10% Me2SO and 10% PG. In the third experiment, we examined various concentrations of PG on the cell proliferative capacity of freeze-thawed hADSCs. The cell proliferative capacity of hADSCs frozen with LR-3 T-5D containing 2.5% to 5% PG was significantly higher (p < 0.05) than LR-3 T-5D containing 10% PG. Furthermore, the cell proliferative capacity of hADSCs frozen with LR-3 T-5D containing 4% PG was similar to that of fresh hADSCs. These results indicate that the combination of 3 T-5D in an LR solution as a basic solution is effective for post-thaw cell viability, and that the optimal concentration of PG to maintain the cell characteristics of hADSCs frozen with LR-3 T-5D is 2.5% to 5%, which is promising for cell therapy applications

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

<p>Abstract</p> <p>Background</p> <p>Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine <it>PRNP</it> (b<it>PRNP</it>) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down b<it>PRNP</it> were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of <it>PRNP</it>, and lengths of siRNAs.</p> <p>Results</p> <p>Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNA^Valpromoter. Six target sites of bovine <it>PRNP </it>were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire b<it>PRNP </it>coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or <it>Renilla </it>luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a <it>Bsp </it>MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.</p> <p>Conclusion</p> <p>Four siRNA expression plasmid vectors, six target sites of b<it>PRNP</it>, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of b<it>PRNP </it>in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.</p

EFFECT OF FERULIC ACID ON PIG OOCYTES

The value of laboratory and genetically-modified pigs is becoming increasingly clear; however, their in vitro development remains inefficient. Trans-ferulic acid (trans-FA) is an aromatic compound that is abundant in plant cell walls, and which exhibits antioxidant effects in vitro. Trans-FA is known to improve sperm viability and motility; however, its effects on porcine oocytes are unknown. Our aim was to investigate the effects of trans-FA supplementation during in vitro maturation on the meiotic and developmental competence of porcine oocytes. Oocytes were matured either without (control) or with trans-FA (10, 100 and 1,000 µM), fertilized, and cultured in vitro for 7 days. The maturation rate of oocytes cultured with 10 µM trans-FA (81.6%) was significantly higher than that of controls (65.0%; P<0.05). The fertilization rate of oocytes matured with 10 µM trans-FA (57.4%) was also significantly higher than that of controls (32.7%) and oocytes cultured with other concentrations (33.1% and 22.7% for 100 and 1,000 µM, respectively; P<0.05). Moreover, the blastocyst formation rate of oocytes matured with 10 µM trans-FA (6.9%) was significantly higher than that of controls (2.3%; P<0.05). Our results suggest that in vitro maturation with 10 µM trans-FA is beneficial for the in vitro production of porcine embryos and has the potential to improve production system

Canine follicular development treated by hormones

Ovarian follicular dynamics is not well known in dogs. Imaging of ovaries is technically difficult; however, ovaries clamped at a subcutaneous site can more easily be monitored using ultrasound imaging. This study investigated the follicular development of canine ovaries stimulated by hormone treatment using ultrasound imaging of the ovaries clamped at a subcutaneous site. Oestrus was induced using subcutaneous administration of 500 IU equine chorionic gonadotropin (eCG) and 1000 IU human chorionic gonadotropin (hCG) (eCG/hCG). Five bitches were given 1000 IU hCG 11 days after eCG/hCG administration. Examinations with ovarian ultrasonography using a 7.5‐MHz sector transducer, vaginal cytology, and assays of serum oestrogen and progesterone were performed daily until 20 days after eCG/hCG administration. Serosanguineous vaginal discharges and vaginal cytology of two of the bitches were observed. New follicular growth (>1.0 mm in diameter) was observed in all bitches from 2 to 8 days after eCG/hCG administration. The mean diameter of follicles and maximum numbers of follicles per ovary ranged from 2.8 to 5.5 mm and 4 to 16, respectively. The elevation in oestrogen concentrations after eCG/hCG administration was observed in all bitches, and elevation in progesterone concentration (>2 ng mL−1) was observed in three bitches. However, no follicles ovulated until 9 days after hCG administration. In conclusion, although the number of examined bitches were limited, follicular growth in ovaries clamped at a subcutaneous site can be monitored using ultrasound imaging. Ovarian ultrasonography showed that eCG/hCG administration induced new follicular growth and hCG administration induced increases in oestrogen concentrations but not ovulation by hCG administration

Fishery Characteristics and Management in the Floodplain Lakes of Tana River delta, Kenya

Tana River delta floodplain is maintained through a dynamic balance revolving around frequency, extent, and flooding duration. These seasonal and annual flooding variations strongly affect the floodplain communities' fisheries and livelihoods. In the delta, fishing is an important traditional source of livelihood, practiced alongside local agrarian livelihoods such as shifting cultivation and livestock keeping. Fishery utilization and management characteristics in the Tana River delta floodplain lakes are not well documented. This study investigated the characteristics and management of small-scale fisheries in the Tana River delta floodplain lakes. Information relating to past flooding events, fishery characteristics, prevailing regulatory regimes, and the impacts of seasonal flooding were collected using field observations. We collected the information at awareness workshops and key informant interviews between June and September 2018, which covers a significant flooding period of that year, and August 2021, a relatively dry period in the delta. We collected the information from communities living around floodplain lakes in Tarassa and Ngao in the southern part of the delta and Tamaso and Lango la Simba areas in the eastern part of the delta. Results indicate that fishery resources are more diverse during flooding (new species recruitment, presence of spawning, breeding, and foraging sites). The community does fishing all year round, and some part-time practice fishing to supplement shifting cultivation and dry season grazing that are greatly affected by periodic flooding. Floods were crucial in enriching floodplain lakes with diverse fish species. Women are involved in fish trading, acquiring fish primarily within their lineage. Fish is mainly sold in local markets due to poor preservation leading to low-value addition. This study recommends a comprehensive value chain analysis to improve it. Fishing communities around the villages are also most vulnerable to climate change because fishery resource governance needs strengthening, and most households are not involved in resource management. Besides, fishers have limited livelihood options due to lacking skills, technologies, and knowledge to undertake climate adaptation-related decisions. We recommend desilting floodplain lakes and improving connectivity with the main river channel. Additionally, an urgent need is to institute a co-management system to bring together different user groups around these floodplain lakes. Keywords: Fisheries, Flooding, Livelihoods, Floodplain lakes, Governance, Tana River delta DOI: 10.7176/JEES/13-2-02 Publication date:March 31st 202

One-Step Generation of Multiple Gene-Edited Pigs by Electroporation of the CRISPR/Cas9 System into Zygotes to Reduce Xenoantigen Biosynthesis

Xenoantigens cause hyperacute rejection and limit the success of interspecific xenografts. Therefore, genes involved in xenoantigen biosynthesis, such as GGTA1, CMAH, and B4GALNT2, are key targets to improve the outcomes of xenotransplantation. In this study, we introduced a CRISPR/Cas9 system simultaneously targeting GGTA1, CMAH, and B4GALNT2 into in vitro-fertilized zygotes using electroporation for the one-step generation of multiple gene-edited pigs without xenoantigens. First, we optimized the combination of guide RNAs (gRNAs) targeting GGTA1 and CMAH with respect to gene editing efficiency in zygotes, and transferred electroporated embryos with the optimized gRNAs and Cas9 into recipient gilts. Next, we optimized the Cas9 protein concentration with respect to the gene editing efficiency when GGTA1, CMAH, and B4GALNT2 were targeted simultaneously, and generated gene-edited pigs using the optimized conditions. We achieved the one-step generation of GGTA1/CMAH double-edited pigs and GGTA1/CMAH/B4GALNT2 triple-edited pigs. Immunohistological analyses demonstrated the downregulation of xenoantigens; however, these multiple gene-edited pigs were genetic mosaics that failed to knock out some xenoantigens. Although mosaicism should be resolved, the electroporation technique could become a primary method for the one-step generation of multiple gene modifications in pigs aimed at improving pig-to-human xenotransplantation

Effects of skim-milk supplementation on the quality and penetrating ability of boar semen after long-term preservation at 15 °C

This study investigated the effects of skim-milk supplementation on the quality and penetrating ability of boar semen preserved at 15 °C. When boar semen samples were preserved in Modified Modena extender supplemented with various concentrations (0, 7.5, 15, 30 and 50 mg/mL) of skim milk powder at 15 °C for 4 weeks, higher sperm motility and viability were observed in the case of 7.5 mg/mL skim-milk supplementation compared with the control group (0 mg/mL) during the preservation (P < 0.05). When in vitro matured oocytes were co-incubated with boar sperm that had been preserved in Modified Modena extender with three different concentrations (0, 7.5 or 15 mg/mL) of skim milk powder at 15 °C for two weeks, there were no apparent effects of skim-milk supplementation on the rates of fertilisation and development to blastocysts of oocytes after co-incubation. However, the monospermic fertilisation rate of sperm preserved with 15 mg/mL skim milk powder was higher (P < 0.05) than that of fresh non-preserved sperm, but did not differ among the preservation groups. The results indicate that the supplementation of Modified Modena extender with 7.5 mg/mL skim milk powder improves the motility and viability, but not the penetrating ability, of sperm after liquid preservation for at least two weeks