Capital Markets and Foreign Ownership Restrictions: An Empirical Analysis of Emerging Stock Markets

In the 1990s, the hot issue in international finance was the growing interest of portfolio managers in the emerging stock markets. The interest in the emerging markets gained rapid attention, which is evident from the global trends, towards the opening up of economies and financial markets, free capital flow and the privatisation of financial institutions. Earlier the emerging markets were isolated due to several factors that had posed serious problems for international investors. These markets lacked the depth, regulatory framework, and structural safeguards that had characterised the equity markets in the developed world. Capital markets are called integrated, if assets with perfectly correlated rates of returns have the same price regardless of the location in which they are traded. Alternatively, capital market are called segmented, if financial assets traded in different markets “with identical risk characteristics” have different returns due to different investment restrictions.1 Segmentation may be due to individuals’ attitudes, government restrictions over capital movements or irrationality. In the past twenty-five years, modern finance theory has proved to be a major development in finance, which comprises of portfolio theory, capital market theory and efficient market theory. These modern developments can be traced back to the work of Markowitz (1959); Sharpe (1964); Solnik (1974) etc., which assumes that security prices fully reflect all publicly available information. Due to this information, potential investors can gain benefits through international diversification. The major attraction of forming international portfolios lies in the potential for risk reduction through diversification of unsystematic risk.

A novel category detection of social media reviews in the restaurant industry

Social media platforms have enabled users to share their thoughts, ideas, and opinions on different subject matters and meanwhile generate lots of information which can be adopted to understand people’s emotion towards certain products. This information can be effectively applied for Aspect Category Detection (ACD). Similarly, people’s emotions and recommendation-based Artificial Intelligence (AI)-powered systems are in trend to assist vendors and other customers to improve their standards. These systems have applications in all sorts of business available on multiple platforms. However, the current conventional approaches fail in providing promising results. Thus, in this paper, we propose novel convolutional attention-based bidirectional modified LSTM by combining the techniques of the next word, next sequence, and pattern prediction with ACD. The proposed approach extracts significant features from public reviews to detect entity and attribute pair, which are treated as a sequence or pattern from a given opinion. Next, we trained our word vectors with the proposed model to strengthen the ACD process. Empirically, we compare the approach with the state-of-the-art ACD models that use SemEval-2015, SemEval-2016, and SentiHood datasets. Results show that the proposed approach effectively achieves 78.96% F1-Score on SemEval-2015, 79.10% F1-Score on SemEval-2016, and 79.03% F1-Score on SentiHood which is higher than the existing approaches

Changes in pH and organic acids in mucilage of Eriophorum angustifolium roots after exposure to elevated concentrations of toxic elements

This is the postprint version of the article. The published article is available at www.springerlink.comThe presence of Eriophorum angustifolium in mine tailings of pyrite maintains a neutral pH, despite weathering, thus lowering the release of toxic elements into acid mine drainage water. We investigated if the presence of slightly elevated levels of free toxic elements triggers the plant rhizosphere to change the pH towards neutral by increasing organic acid content. Plants were treated with a combination of As, Pb, Cu, Cd and Zn at different concentrations in nutrient medium and in soil in a rhizobox-like system for 48-120 hrs. The pH and organic acids were detected in the mucilage dissolved from root surface, reflecting the rhizosphere solution. Also the pH of root-cell apoplasm was investigated. Both apoplasmic and mucilage pH increased and the concentrations of organic acids enhanced in the mucilage with slightly elevated levels of toxic elements. When organic acid concentration was high, also the pH was high. Thus, efflux of organic acids from the roots of E. angustifolium may induce rhizosphere basification

Terbufos sulfon pogoršava srčane lezije u štakora koji boluju od dijabetesa: studija subakutne toksičnosti

Organophosphorus compounds (OPCs) have a wide range of applications, from agriculture to warfare. Exposure to these brings forward a varied kind of health issues globally. Terbufos is one of the leading OPCs used worldwide. The present study investigates the cardiac effect of no observable dose of a metabolite of terbufos, terbufos-sulfone (TS), under nondiabetic and streptozotocin-induced diabetic condition. 100 nmol per rat (1/20 of LD50) was administered intraperitoneally to adult male Wister rats daily for fifteen days. The left ventricle was collected for ultrastructural changes by transmission electron microscopy. The blood samples were collected for biochemical tests including RBC acetylcholinesterase, creatinine kinase (CK), lactate dehydrogenase (LDH), cholesterol, high density lipoprotein (HDL), low density lipoprotein (LDL), triglycerides, ALT, AST, and GGT. The study revealed about 10 % inhibition of RBC-AChE in two weeks of TS treatment in non-diabetic rats whereas RBC-AChE activity was significantly decreased in diabetic TS treated rats. CK, LDH, and triglycerides were significantly higher in diabetic TS treated rats. Electron microscopy of the heart showed derangement and lesions of the mitochondria of cardiomyocytes in the TS treated groups. The present study concludes that a non-lethal dose of TS causes cardiac lesions which exacerbate under diabetic condition. Biochemical tests confirmed the ultrastructural changes. It is concluded that a non-lethal dose of TS may be a risk factor for a cardiovascular disease, which may be fatal under diabetic condition.Organofosforni spojevi (eng. Organophosphorous Compounds - OPCs) imaju široku primjenu, od one u poljoprivredi do one u vojne svrhe. Izlaganje takvim spojevima izaziva niz različitih zdravstvenih problema od globalnog značaja. Terbufos je jedan od vodećih OPC-a koji se koriste diljem svijeta. U ovom je istraživanju na modelu štakora bez dijabetesa sa streptozotocinom izazvanim dijabetesom ispitivan metabolit terbufos-sulfon (TS) u najvišoj dozi koja ne izaziva učinak te njezin utjecaj na srce. Odrasli mužjaci štakora soja Wistar dobivali su petnaest dana dnevnu dozu od 100 nmol štakor-1 (1/20 LD50) intraperitonealno. Transmisijskim elektronskim mikroskopom istražene su ultrastrukturne promjene lijeve klijetke. Na krvnim uzorcima provedeni su biokemijski testovi, uključujući aktivnost acetilkolinesteraze u crvenim krvnim stanicama, razinu kreatinin kinaze (CK), laktat dehidrogenaze (LDH), kolesterola, lipoproteina visoke gustoće (HDL), lipoproteina niske gustoće (LDL), triglicerida, ALT, AST i GGT. Istraživanjem je otkriveno oko 10 % inhibicije AChE-a u crvenim krvnim stanicama nakon dva tjedna izlaganja štakora bez dijabetesa TS-u, dok je u štakora s dijabetesom aktivnost AChE-a bila značajno smanjena. Razine CK, LDH i triglicerida bile su značajno više u TS tretiranim štakorima s dijabetesom. Elektronsko-mikroskopska analiza srca upućuje na narušenu strukturu i lezije u mitohondrijima u kardiomiocitima skupina štakora koji su tretirani TS-om. Zaključuje se da nesmrtonosna doza TS-a uzrokuje srčane lezije koje se pogoršavaju u prisutnosti dijabetesa. Biokemijski testovi potvrdili su ultrastrukturne promjene. Navedena doza TS-a može biti rizični čimbenik za kardiovaskularne bolesti, koje se mogu pokazati smrtonosnima uz istovremeno postojanje dijabetesa

An Investigation of Household Reproductive Behaviour in Pakistan

Our present concern is with fertility determinants on Pakistan. Based on the household data co11cted in connection with PIDE/ILO project "Studies in Population, Labour Ircrce and Migration in Pakistan" an attempt is made to ascertain the influence of various socio-economic variables on household fertility decision making. The analysis which follows is preliminary in nature and can be characterised as taking a general socio-economic approach. Various fertility measures available from the survey are described in this paper followed by a discussion on the choice and specification of independent variables in the next section. Regression results are presented in the third section

In vitro inter-relationship between plant growth promoting rhizobacteria and root knot nematode (Meloidogyne incognita) and their effect on growth parameters of brinjal

The influence of rhizobacteria as the treatment on germination, migration and penetration of Meloidogyne incognita in brinjal was evaluated under laboratory conditions. The results obtained were highly significant and revealed that Pseudomonas fluorescens promotes germination 87.5% and was effective in reducing root penetration by Meloidogyne incognita i.e. 39.3 juviniles. Due to the effect of P. fluorescens, the plant height increased by 40.9%, number of leaves was maximum i.e., 50%, number of gall formation was also controlled i.e., 70.3%. It was concluded from the studies that rhizobacterium Pseudomonas fluorescens is a potential biocontol agent and it has ability to increase the yield and suppress the attack of plant pathogen

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei

Multi-criteria relationship analysis of knowledge, perception, and attitude of stakeholders for engagement towards maritime pollution at sea, beach, and coastal environments

The external influence due to the severe repercussions of unprecedented and un-attended pollution has put vulnerable marine ecosystems at high risk of irreversible damage. This business-as-usual scenario could render them unfit to offer sustenance along with innumerable ecosystem services. Since the Stockholm Conference on Human Environment 1972, there have been global efforts to raise awareness, build capacity, and govern the pollution issue for a sustainable solution. However, there is a growing concern about the adequacy of the desired level of mobilization and readiness so far achieved at the level of various stakeholders to respond to the issue of maritime pollution. In this context, the present study was aimed at assessing the relationship between knowledge, perception, and attitude of the stakeholders regarding their engagement towards maritime pollution at sea, beach, and coastal environments, by incorporating multi-criteria quantitative analysis method for a case study of Karachi area in Pakistan. The structured questionnaire incorporates Knowledge, Perception, and Attitude as three key variables for three principles; four standardized criteria each, with eighteen indicators transformed into queries by applying MCDA’s Simple Multi Attribute Rating (SMART) technique for scoring to quantify the feedback of 304 respondents through a ratio scale having nominal qualifiable classes. The analysis has offered insight into the ways the stakeholders are perpetrating pollution and how their respective actions are important in the abatement of marine pollution. One-tailed Pearson Correlation analysis reveals insignificant relationship between the variables, indicating that the level of understanding of the stakeholders has not developed opinions to an extent that would enable an appropriate behavioral approach toward the abatement of the pollution. It suggests inducing awareness, mobilization, and reforms to encourage collective action by all actors

Cross Sectional Study and Risk Factors Analysis of Francisella tularensis in Soil Samples in Punjab Province of Pakistan

Tularemia is an endemic zoonotic disease in many parts of the world including Asia. A cross-sectional study was conducted to determine genome-based prevalence of Francisella tularensis (Ft) in soil, assess an association between its occurrence in soil and likely predictors i.e., macro and micro-nutrients and several categorical variables, and determine seroconversion in small and large ruminants. The study included a total of 2,280 soil samples representing 456 villages in eight districts of the Punjab Province of Pakistan followed by an analysis of serum antibodies in 707 ruminants. The genome of Ft was detected in 3.25% (n = 74, 95% CI: 2.60–4.06) of soil samples. Soluble salts (OR: 1.276, 95% CI: 1.043–1.562, p = 0.015), Ni (OR: 2.910, 95%CI: 0.795–10.644, p = 0.106), Mn (OR:0.733, 95% CI:0.565–0.951, p = 0.019), Zn (OR: 4.922, 95% CI:0.929–26.064, p = 0.061) and nutrients clustered together as PC-1 (OR: 4.76, 95% CI: 2.37–9.54, p = 0.000) and PC-3 (OR: 0.357, 95% CI: 0.640, p = 0.001) were found to have a positive association for the presence of Ft in soil. The odds of occurrence of Ft DNA in soil were higher at locations close to a water source, including canals, streams or drains, [χ2 = 6.7, OR = 1.19, 95% CI:1.05–3.09, p = 0.004] as well as places where animals were present [χ2 = 4.09, OR = 2.06, 95% CI: 1.05–4.05, p = 0.02]. The seroconversion was detected in 6.22% (n = 44, 95% CI: 4.67–8.25) of domestic animals. An occurrence of Ft over a wide geographical region indicates its expansion to enzootic range, and demonstrates the need for further investigation among potential disease reservoirs and at-risk populations, such as farmers and veterinarians