Practical application and clinical impact of the WHO histopathological criteria on bone marrow biopsy for the diagnosis of essential thrombocythemia versus prefibrotic primary myelofibrosis

Aims: To evaluate the feasibility of the histopathological diagnosis of prefibrotic–early primary myelofibrosis (PM) as described in the World Health Organization (WHO) classification and to evaluate the clinical implications of prefibrotic–early PM in a series of patients previously diagnosed as having essential thrombocythemia (ET) according to the Polycythemia Vera Study Group criteria. Methods and results: WHO criteria were applied to bone marrow biopsy specimens by two pathologists who then reclassified 127 cases as 102 ET (80.3%), 18 prefibrotic–early PM (14.2%) and seven fibrotic PM (5.5%). In 45 cases (35%), the final diagnosis was only reached by consensus. The megakaryocytic criteria that best discriminated between ET and prefibrotic–early PM were an increased nucleo–cytoplasmic ratio, presence of cloudlike nuclei, hyperchromatic-dysplastic nuclei, paratrabecular megakaryocytes and tight clusters. A histological score discriminated between ET (score ≤3) and PM (score ≥6), but 21 cases showed an intermediate ambiguous score. No significant differences were observed at diagnosis and at follow-up (median time 93 months) for thrombosis, major haemorrhage, laboratory data, transformation into overt myeloid metaplasia and survival. Conclusions: The distinction between ET and prefibrotic–early PM is impaired by subjectivity in pathological practice and is of questionable clinical relevance, at least when considering individual patients

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

A novel hybrid material with calcium and strontium release capability

The preparation of PDMS–TEOS–CaO hybrid materials by sol–gel techniques has been widely described in previous works. Calcium nitrate is the most common source of calcium used in these preparations. However, to remove possible toxic nitrate by-products a thermal treatment is necessary at temperatures above 500 1C, which leads to the degradation of the polymeric components of the hybrids. Strontium has already shown some promising results in the therapeutic area, being used in cases of osteoporosis and low bone density. In this study a new potential bioactive hybrid material was prepared, by sol–gel techniques, using calcium acetate as a novel calcium source. Also, for the first time, incorporation of strontium in a PDMS–TEOS hybrid system was evaluated. Samples were characterized before and after immersion in Kokubo’s Simulated Body Fluid (SBF) by SEM, EDS, ICP and FT-IR spectroscopy

Predicting live birth, preterm and low birth weight infant after in-vitro fertilisation: a prospective study of 144018 treatment cycles

Background The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown. Methods and Findings We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF) cycles undertaken in the UK between 2003 and 2007 (n = 144,018). We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI) as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226), we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2–23.7). In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46–1.71) more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99–1.24); p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia increased with advancing maternal age and a history of previous live births. Infertility due to cervical problems was associated with increased odds of all three outcomes—preterm birth, low birth weight, and macrosomia. Conclusions Pending external validation, our results show that couple- and treatment-specific factors can be used to provide infertile couples with an accurate assessment of whether they have low or high risk of a successful outcome following IVF

Oxide phase characterization in simulated high burn-up UO2 fuels in the early stages of a nuclear severe accident

International audienc

The INeS study: prevention of multiple pregnancies: a randomised controlled trial comparing IUI COH versus IVF e SET versus MNC IVF in couples with unexplained or mild male subfertility

BACKGROUND Multiple pregnancies are high risk pregnancies with higher chances of maternal and neonatal mortality and morbidity. In the past decades the number of multiple pregnancies has increased. This trend is partly due to the fact that women start family planning at an increased age, but also due to the increased use of ART. Couples with unexplained or mild male subfertility generally receive intrauterine insemination IUI with controlled hormonal stimulation (IUI COH). The cumulative pregnancy rate is 40%, with a 10% multiple pregnancy rate. This study aims to reveal whether alternative treatments such as IVF elective Single Embryo Transfer (IVF e SET) or Modified Natural Cycle IVF (MNC IVF) can reduce the number of multiple pregnancy rates, but uphold similar pregnancy rates as IUI COH in couples with mild male or unexplained subfertility. Secondly, the aim is to perform a cost effective analyses and assess treatment preference of these couples. METHODS/DESIGN We plan a multicentre randomised controlled clinical trial in the Netherlands comparing six cycles of intra-uterine insemination with controlled ovarian hyperstimulation or six cycles of Modified Natural Cycle (MNC) IVF or three cycles with IVF-elective Single Embryo Transfer (eSET) plus cryo-cycles within a time frame of 12 months. Couples with unexplained subfertility or mild male subfertility and a poor prognosis for treatment independent pregnancy will be included. Women with anovulatory cycles, severe endometriosis, double sided tubal pathology or serious endocrine illness will be excluded. Our primary outcome is the birth of a healthy singleton. Secondary outcomes are multiple pregnancy, treatment costs, and patient experiences in each treatment arm. The analysis will be performed according tot the intention to treat principle. We will test for non-inferiority of the three arms with respect to live birth. As we accept a 12.5% loss in pregnancy rate in one of the two IVF arms to prevent multiple pregnancies, we need 200 couples per arm (600 couples in total). DISCUSSION Determining the safest and most cost-effective treatment will ensure optimal chances of pregnancy for subfertile couples with substantially diminished perinatal and maternal complications. Should patients find the most cost-effective treatment acceptable or even preferable, this could imply the need for a world wide shift in the primary treatment. TRIAL REGISTRATION Current Controlled Trials ISRCTN 52843371Alexandra J Bensdorp, Els Slappendel, Carolien Koks, Jur Oosterhuis, Annemieke Hoek, Peter Hompes, Frank Broekmans, Harold Verhoeve, Jan Peter de Bruin, Janne Meije van Weert, Maaike Traas, Jacques Maas, Nicole Beckers, Sjoerd Repping, Ben W Mol, Fulco van der Veen and Madelon van Wel

Outcome of Ph negative myeloproliferative neoplasms transforming to accelerated or leukemic phase

Myeloproliferative neoplasms (MPN) are chronic disorders that can sometimes evolve into accelerated or leukemic phases. We retrospectively identified 122 patients with such blastic phases. The overall median survival was four months: 10.2 months for patients treated with intensive treatments compared to three months for best supportive care (p = .005). Azacytidine, intensive chemotherapies, or allogeneic stem cell transplantation gave the highest median survivals with 9, 10.2, and 19.4 months, respectively. Accelerated phases (AP) had a longer median survival compared to acute leukemia (4.8 months vs. 3.1 months; p = .02). In this retrospective and observational study, we observe that the longest survivals are seen in patients eligible for intensive treatments. Azacytidine shows interesting results in patients non-fit for intensive chemotherapy. Supportive care should probably be restricted to elderly patients and those with unfavorable karyotype. An early diagnosis of AP could also result in a better survival rate

Flow cytometry-evaluated platelet CD36 expression, reticulated platelets and platelet microparticles in essential thrombocythaemia and secondary thrombocytosis

International audienc

Abnormal T-cell phenotype in episodic angioedema with hypereosinophilia (Gleich's syndrome): frequency, clinical implication and prognosis

BACKGROUND: Episodic Angioedema with eosinophilia (EAE, Gleich\u27s syndrome) is a rare disorder consisting of recurrent episodes of angioedema, hypereosinophilia and frequent elevated serum Immunoglobin M. METHODS: We conducted a retrospective multicenter nationwide study regarding the clinical spectrum and therapeutic management of patients with EAE in France. RESULTS: Thirty patients were included with a median age at diagnosis of 41 years [5-84]. The median duration of each crisis was 5.5 days [1-90] with swelling affecting mainly the face and the upper limbs. Total serum IgM levels were increased in 20 patients (67%). Abnormal T-cell immunophenotypes were detected in 12 patients (40%) among which 5 (17%) showed evidence of clonal TCR γ gene rearrangement. Median follow-up duration was 53 months [31-99]. The presence of an abnormal T-cell population was the sole factor associated with a shorter time to flare (hazard ratio 4.15 [CI 95% 1.18-14.66; p=0.02). At last follow-up, 3 patients (10%) were able to withdraw all treatments and 11 (37%) were in clinical and biological remission with less than 10 mg of daily prednisone. CONCLUSION: EAE is a heterogeneous condition that encompasses several disease forms. Although patients usually respond well to glucocorticoids, those with evidence of abnormal T-cell phenotype have a shorter time to flare