Echo Features of Posteromedial Papillary Muscle Rupture without Papillary Muscle Prolapse into the Left Atrium

A 67-year-old male presented to the hospital emergency department with a 3-day history of decreased exercise tolerance, fatigue and exertional chest tightness. These symptoms began after an initial episode of prolonged chest pain associated with diaphoresis and dyspnea.. The admission electrocardiogram (EKG) and cardiac "markers" were consistent with a recent inferolateral myocardial infarction (MI). There was no history of cardiovascular disease. Risk factors were that of a family history of heart disease, long-standing tobacco use and elevated lipids. The patient was on no medications. Bedside echocardiography (TTE) revealed left ventricular (LV) basal inferior-inferolateral aneurysmal formation with mild mitral regurgitation (MR). Significant aortic sclerosis was noted (movie clip S1). Because of continued exertional chest pain up through admission, diagnostic angiography was performed. The coronary tree was codominant, with only disease in the circumflex system noted. A large obtuse marginal (OM) branch of the circumflex artery was occluded and could not be opened percutaneously. Left ventriculography was consistent with findings by TTE, with inferobasal dyskinesis noted. The following morning, the patient developed sudden dyspnea, hypotension and pulmonary edema. Cardiac auscultation revealed only a soft systolic murmur, heard at the left sternal border and also apex. The EKG was unchanged, except that Mobitz Type I AV block developed. The patient required endotracheal intubation with mechanical ventilation, along with inotropic support. Address for correspondence and reprint requests: Edmund Kenneth Kerut, M.D., Heart Clinic of Louisiana, 1111 Medical Center Blvd, Suite N613, Marrero, LA 70072. Fax: 504-349-6621; E-mail: [email protected] A second bedside TTE was performed. Twodimensional imaging revealed new prolapse of the posterior mitral valve leaflet, "erratic" reverberations within the LV cavity, and evidence of severe MR by Doppler interrogation Based on the clinical scenario and suggestive findings by TTE, transesophageal echocardiography (TEE) was performed. Findings confirmed rupture of the posteromedial (PM) papillary muscle An intraaortic balloon pump (IABP) was placed and the patient taken to the operating room, where the PM papillary muscle was found to be ruptured In the setting of myocardial infarction, papillary muscle rupture is rather an uncommon event, occurring in 1% to 3% of patients with acute MI

Satellite data relay and platform locating in oceanography. Report of the In Situ Ocean Science Working Group

The present and future use of satellites to locate offshore platforms and relay data from in situ sensors to shore was examined. A system of the ARGOS type will satisfy the increasing demand for oceanographic information through data relay and platform location. The improved ship navigation provided by the Global Positioning System (GPS) will allow direct observation of currents from underway ships. Ocean systems are described and demand estimates on satellite systems are determined. The capabilities of the ARGOS system is assessed, including anticipated demand in the next decade

DREADDs in Drosophila: A Pharmacogenetic Approach for Controlling Behavior, Neuronal Signaling, and Physiology in the Fly

SummaryWe have translated a powerful genetic tool, designer receptors exclusively activated by designer drugs (DREADDs), from mammalian systems to Drosophila melanogaster to selectively, rapidly, reversibly, and dose-dependently control behaviors and physiological processes in the fly. DREADDs are muscarinic acetylcholine G protein-coupled receptors evolved for loss of affinity to acetylcholine and for the ability to be fully activated by an otherwise biologically inert chemical, clozapine-N-oxide. We demonstrate its ability to control a variety of behaviors and processes in larvae and adults, including heart rate, sensory processing, diurnal behavior, learning and memory, and courtship. The advantages of this particular technology include the dose-responsive control of behaviors, the lack of a need for specialized equipment, and the capacity to remotely control signaling in essentially all neuronal and nonneuronal fly tissues

Enhancement of the recycling and activation of β-adrenergic receptor by Rab4 GTPase in cardiac myocytes,”

Abstract We investigate the role of Rab4, a Ras-like small GTPase coordinating protein transport from the endosome to the plasma membrane, on the recycling and activation of endogenous β-adrenergic receptor (β-AR) in HL-1 cardiac myocytes in vitro and transgenic mouse hearts in vivo. β 1 -AR, the predominant subtype of β-AR in HL-1 cardiac myocytes, was internalized after stimulation with isoproterenol (ISO) and fully recycled at 4 h upon ISO removal. Transient expression of Rab4 markedly facilitated recycling of internalized β-AR to the cell surface and enhanced β-AR signaling as measured by ISO-stimulated cAMP production. Transgenic overexpression of Rab4 in the mouse myocardium significantly increased the number of β-AR in the plasma membrane and augmented cAMP production at the basal level and in response to ISO stimulation. Rab4 overexpression induced concentric cardiac hypertrophy with a moderate increase in ventricle/body weight ratio and posterior wall thickness and a selective up-regulation of the β-myosin heavy chain gene. These data provide the first evidence indicating that Rab4 is a rate-limiting factor for the recycling of endogenous β-AR and augmentation of Rab4-mediated traffic enhances β-AR function in cardiac myocytes. β-Adrenergic receptors (ARs) 2 are members of the seven transmembrane spanning G proteincoupled receptor (GPCR) family and play a critical role in the regulation of cardiac function in response to cate-cholamine stimulation (1-3). Three subtypes, β 1 -AR, β 2 -AR, and β 3 -AR, have been identified in the mammalian hearts. β 1 -AR and β 2 -AR are major mediators of cardiac contractility through coupling to heterotrimeric G proteins to regulate the activation of adenylyl cyclases, which in turn modulates production of intracellular cAMP and activation of protein kinase A. β 1 -AR couples to the stimulatory G protein Gs, whereas β 2 -AR couples to both G s and the inhibitory G protein G i NIH Public Access Rab proteins are Ras-like small GTPases that regulate vesicular protein transport in both endocytosis and exocytosis (6, In this report, we investigated the effect of augmentation of Rab4 function on the recycling and activation of endogenous β-AR in both cardiac myocytes in vitro and mouse hearts in vivo. Our data demonstrated that increased wild-type Rab4 expression facilitated recycling to the plasma membrane and signaling of β-AR in cultured HL-1 cardiac myocytes. Our results also showed that cardiac specific overexpression of wild-type Rab4 augmented the membrane targeting and function of β-AR. Furthermore, overexpression of wild-type Rab4 induced cardiac hypertrophy with preserved contractile function. These data provide the first evidence indicating that endogenous Rab4 expression level is a rate-limiting factor for the recycling of endogenous β-AR and that augmentation of Rab4-mediated traffic enhances β-AR function in cardiac myocytes. EXPERIMENTAL PROCEDURES Materials Antibodies against Rab1, Rab4, Rab5, G s , G i , Gβ, GRK2, and calregulin were purchased from Santa Cruz Biotechnology, Inc. Anti-GM130 antibody was from BD Transduction Laboratories. Antibody against Na + -K + -ATPase was from Affinity Bio-Reagents (Golden, CO Ci/mmol) and [ 3 H]CGP12177 (specific activity = 51 Ci/mmol) were from Amersham Biosciences. All other materials were obtained as described elsewhere Culture and Transfection of HL-1 Cardiomyocytes HL-1 myocytes were plated onto 12-well plates at a density of 4 × 10 5 cells/well and cultured in Claycomb medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 0.1 mM norepinephrine, and 2 mM L-glutamine as described previously (23). Rab4 was tagged with FLAG epitope at the amino terminus of Rab4 (FLAG-Rab4) by PCR using a primer GACTACAAGGACGACGATGACAAG coding a peptide DYKDDDDK. The FLAG epitope has been used to label a number of proteins resulting in tagged-proteins with similar characteristics to their respective wild-types (24). After 24-h culture without norepinephrine, HL-1 myocytes were transiently transfected with 2 μg of Rab4 or the pcDNA3 vector using Lipofectamine 2000 reagent (Invitrogen) as described previously (23). Ligand Binding in Intact HL-1 Cardiomyocytes Intact cell ligand binding was used to measure cell surface expression of β-AR. HL-1 myocytes were cultured on 12-well plates and incubated with [ 3 H]CGP12177 at a concentration of 20 nM for 2 h at room temperature. To measure the expression of β 1 -AR and β 2 -AR subtypes, the HL-1 cells were preincubated with the β 1 -AR-selective antagonist atenolol (20 μM) or the β 2 -AR-selective antagonist ICI118,551 (20 μM) for 30 min. The nonspecific binding was determined in the presence of alprenolol (20 μM). After washing twice with ice-cold phosphatebuffered saline (1 ml each time), the cells were digested with 1 ml of 1 M NaOH. The radioactivity was counted by liquid scintillation spectrometry in 5 ml of Ecoscint A scintillation solution (National Diagnostics, Inc., Atlanta, GA). Measurement of β-AR Internalization and Recycling in HL-1 Myocytes β-AR internalization in response to stimulation with ISO and recycling of internalized receptors were determined as essentially described (9,12) with modifications. Briefly, HL-1 myocytes were cultured on 12-well plates and transfected as described above. At 48 h after transfection, the cells were incubated with ISO at a concentration of 10 μM for different times at 37 °C to initiate receptor internalization. The cells were washed twice with 1 ml of ice-cold Dulbecco's modified Eagle's medium to remove ISO and allowed to recover for different time periods (from 15 to 240 min). β-AR expression at the cell surface was then determined by ligand binding as described above. Generation of Rab4 Transgenic Mice Transgenic mice overexpressing Rab4 in the myocardium were generated essentially as described (21). The cDNA encoding FLAG-Rab4 was cloned into exon three of the full-length mouse α-myosin heavy chain (MHC) promoter (21). The entire 7.7-kb transgene fragment containing the entire α-MHC promoter, the complete FLAG-Rab4 cDNA, and a human growth hormone polyadenylation signal sequence was released from the plasmid backbone by digestion with BamHI and was used for microinjection into pronuclei of fertilized mouse oocytes (FVB/N background) using standard techniques (Pennington Biomedical Research Institute, Louisiana State University, Baton Rouge, LA). Transgenic mice were identified by Southern blot or PCR analysis using genomic DNA extracted from mouse tails. All studies were performed in Rab4 transgenic mice and nontransgenic (NTG) siblings at 22 weeks old in accordance with protocols approved by the Louisiana State University Health Sciences Center Institutional Animal Care and Use Committee. Measurement of Cardiac β-AR Expression β-AR density was measured as described Measurement of cAMP Production cAMP production in response to stimulation with ISO or forskolin was measured in the presence of 3-isobutyl-1-methylxanthine (0.5 mM), a phosphodiesterase inhibitor, by using cAMP enzymeimmunoassay system (Biotrak, Amersham Biosciences) as described (26). For measurement of cAMP production by membrane fractions prepared from NTG and Rab4 transgenic mouse ventricles, an aliquot of membrane fraction (about 0.8 μg of protein) was transferred into microtiter plates and then incubated with anti-cAMP antiserum, followed by the incubation with cAMP-peroxidase. After washing and addition of substrate, peroxidase activity was measured by spectrometry. cAMP concentrations were calculated based on the competition of cAMP in samples with a fixed quantity of peroxidase-labeled cAMP. For measurement of cAMP production in cultured cardiomyocytes, HL-1 cells were cultured in 12-well plates and transfected with 2 μg of Rab4 or pcDNA3 as described above. After 48 h, the cells were stimulated with increasing concentrations of ISO (from 10 −9 to 10 −5 M) or forskolin (100 μM) for 10 min at room temperature. The reactions were stopped by aspirating the medium and then the cells were lysed using 200 μl of dodecyltrimethylammonium (2.5%). One-hundred μl of cell lysate was used to determine cAMP concentration as described above. Measurement of Cardiac Hypertrophy Morphometric analysis and histological examination of Masson's trichrome-and hematoxylineosin-stained ventricles used standard techniques as described previously (21). Cardiac gene expression was assayed by RNA dot blot analysis using total RNA (3 μg/dot) extracted from ventricles of NTG and transgenic mice and 32 P-labeled oligonucleotides as probes (21,27). Radiolabeled RNA dots were quantitated with a PhosphorImager (Amersham Biosciences), and expression of each cardiac gene was normalized to glyceraldehyde-3-phosphate dehydrogenase expression. Echocardiography Mice were anesthetized with avertin (250 mg/kg, intraperitoneal). Cardiac ultrasound studies were performed on Rab4 transgenic mice and NTG sibling controls at 22 weeks old using a SSA770 Aplio Ultrasound system (Toshiba America Medical Systems, Tustin, CA) with a 1204AX linear array transducer scanning at 14 MHz center frequency. Depth setting was 2 cm with a 0.75-cm electronic focus and two-dimensional imaging frame rate of 238 Hz. Twodimensional guided M-mode studies of the left ventricle at the level of the papillary muscles were performed. M-mode measurements were made using the leading-edge to leading-edge Immunoblot Analysis Western blot analysis of protein expression was carried out as described previously (22,23). Proteins were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes. The signal was detected using ECL Reagent Plus (PerkinElmer Life Sciences, Boston, MA) with a Fujifilm Luminescent Image Analyzer (LAS-1000plus) and quantitated using Image Gauge Program (Version 3.4). Protein loading and transfer efficiency were evaluated by Amido Black staining of the membrane after immunoblotting. Statistical Analysis Data are expressed as the mean ± S.E. Differences were evaluated using Student's t test. p < 0.05 was considered as statistically significant. RESULTS Effect of Transient Expression of Rab4 on the Recycling of Internalized β-AR in HL-1 Cardiomyocytes To determine whether Rab4 is involved in the regulation of endogenous β-AR recycling in cardiac myocytes, we choose HL-1 cardiomyocytes, an immortal cardiac muscle cell line that proliferates and retains phenotypic characteristics of cardiomyocytes Internalization of β-AR in response to stimulation with ISO in HL-1 cardiac myocytes was then characterized. ISO stimulation induced internalization of plasma membrane β-AR in a time-and dose-dependent manner In the next series of experiments we determined whether increased Rab4 function could modulate the recycling of internalized β-AR in HL-1 myocytes. HL-1 myocytes were transiently transfected with FLAG-tagged Rab4. Rab4 expression was then determined by Western blotting using FLAG high affinity monoclonal and Rab4 antibodies. The FLAG antibody detected only exogenously transfected Rab4, whereas the Rab4 antibody detected both transfected FLAG-Rab4 and endogenous Rab4. Rab4 expression was about four times higher in the FLAG-Rab4 transfected cells than endogenous Rab4 in cells transfected with the pcDNA3 vector ( NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript The HL-1 myocytes were treated by ISO for 30 min to initiate internalization and then allowed to recover for various period of time (15, 30, 60, 120, and 240 min). After 4 h, β-ARs were fully recycled back to the plasma membrane in myocytes transfected with the pcDNA3 vector Effect of Transient Expression of Rab4 on β-AR Signaling in HL-1 Cardiomyocytes To determine whether Rab4-faciliated recycling of internalized β-AR could modulate β-AR signaling, we measured the effect of transient expression of Rab4 on cAMP production in HL-1 cardiomyocytes. HL-1 myocytes were stimulated with increasing concentration of ISO (from 10 −9 to 10 −5 M) and intracellular cAMP concentrations were then measured. cAMP production in response to ISO stimulation at concentrations from 10 −8 to 10 −5 M was significantly higher in myocytes transfected with Rab4 than myocytes transfected with the pcDNA3 vector Effect of Transgenic Overexpression of Rab4 on β-AR Expression in the Plasma Membrane Preceding data indicate that increased Rab4 function facilitates recycling of internalized endogenous β-AR in cultured HL-1 myocytes. To determine whether increased Rab4 function could influence β-AR recycling in cardiac myocytes in vivo, we generated transgenic mice cardiac-specifically expressing FLAG-tagged Rab4. Transgenic mice were identified by Southern blot and PCR analyses of genomic DNA extracted from mouse tails. Rab4 expression in the ventricles of Rab4 transgenic and NTG mice was determined by Western blot analysis using anti-Rab4 and FLAG antibodies. Rab4 expression in transgenic mouse ventricles was increased by about 12-fold compared with NTG siblings We next determined whether Rab4 overexpression could alter the density of β-AR in the plasma membrane by radioligand binding. As β-AR are synthesized in the ER and transported to the plasma membrane through the Golgi apparatus, any contamination of the ER and/or the Golgi in the plasma membrane fractions would influence the actual number of the receptors in the plasma membrane. Thus, we first determined whether the plasma membrane preparations contained the ER and/or Golgi by measuring the expression of the ER marker calregulin, the Golgi marker GM130, and the plasma membrane marker Na + -K + -ATPase by immunoblotting. Both calregulin and GM130 were exclusively detected in the cytosolic fraction but not in the membrane fraction, whereas Na + -K + -ATPase was detected in the membrane fraction but not in the cytosolic fraction β-AR density was significantly increased in the membrane fraction from Rab4 transgenic mouse ventricles by 22% NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript β-AR density, expression of G s , G i , Gβ, and GRK2, molecules involved in the β-AR signaling, was not altered in Rab4 transgenic mice Effect of Transgenic Overexpression of Rab4 on β-AR Signaling We then determined whether enhanced Rab4 expression in the plasma membrane in vivo could activate β-AR signaling. cAMP production in response to stimulation with ISO was measured using membrane preparations from Rab4 transgenic and NTG mouse ventricles. Consistent with the increased β-AR density in the plasma membrane, ISO-stimulated cAMP production was significantly augmented by 3.3-fold in ventricles from Rab4 transgenic mice as compared with NTG controls Effect of Transgenic Overexpression of Rab4 on Cardiac Hypertrophy and Function The absolute heart and ventricle weights were significantly increased in Rab4 transgenic mice at 22 weeks old as compared with age-matched NTG controls (heart weight: NTG, 0.15 ± 0.01 and Rab4, 0.18 ± 0.01 g, n = 12, p < 0.05; ventricle weight: NTG, 0.13 ± 0.01 and Rab4, 0.16 ± 0.01 g, n = 12, p < 0.05). There was no difference in body weight between Rab4 transgenic and NTG mice (NTG, 32.4 ± 1.1 and Rab4, 31.2 ± 0.7 g), resulting in an increase in heart and ventricle weight-to-body weight ratio in the Rab4 mice Increased expression of cardiac fetal genes is associated with cardiac hypertrophy. To determine whether Rab4 overexpression-induced cardiac hypertrophy, as reflected by increased cardiac mass, is accompanied by an increased expression of hypertrophy-associated genes, we quantified the expression of atrial netriuretic peptide, β-MHC and α-skeletal actin by RNA dot blot. β-MHC expression normalized to the mRNA expression of glyceraldehyde-3-phosphate dehydrogenase was increased by 3.5-fold in Rab4 transgenic mouse hearts as compared with those from NTG mice In vivo M-mode echocardiography was used to determine the effect of Rab4 overexpression on left ventricular dimension at end-diastole (EDD) and end-systole (ESD) and posterior left ventricular wall thickness at end-diastole. Consistent with morphological and gravimetric data, posterior wall thickness in Rab4 transgenic mice was significantly increased by ~30% DISCUSSION Rab4 GTPase coordinates protein transport from the endosome to the plasma membrane The most important finding in this report is that Rab4 functions as a rate-limiting factor for the transport of endogenous β-AR to the plasma membrane. We first demonstrated that the recycling of β-AR after agonist stimulation was significantly facilitated by transient expression of wild-type Rab4 in HL-1 myocytes, in which β 1 -AR is the predominant subtype. To define whether Rab4 could enhance β-AR recycling in the mouse heart in vivo, we generated transgenic mice overexpressing Rab4 in the myocardium and determined the effect of increased Rab4 expression on the plasma membrane expression of β-AR. Chronic expression of Rab4 in the mouse heart moderately, but significantly, increased the density of β-AR in the plasma membrane. As the same numbers of HL-1 cells were used for transfection with control and Rab4 plasmids and the size of the myocytes from Rab4 transgenic mouse hearts were enlarged, it is likely that the receptor density is increased in each myocyte expressing wild-type Rab4. Rab4 expression did not alter β-AR expression at the cell surface before ISO stimulation and after complete recycling at 4 h, suggesting that Rab4 did not alter total β-AR expression. In contrast to the β-AR, expression of Rab1, Rab5, G s , G i , Gβ, and GRK2 was not affected by Rab4 expression, suggesting that altered Rab4 expression did not influence total protein synthesis. As Rab4 has been well demonstrated to regulate protein transport specifically from the endosomes to the plasma memebrane (6, To determine whether overexpression of Rab4 could regulate β-AR signaling as a consequence of modifying β-AR recycling, we measured ISO-stimulated cAMP production in HL-1 cardiomyocytes and in membrane preparations from Rab4 transgenic and NTG mouse hearts. cAMP production in HL-1 cells in response to stimulation at the highest concentration of ISO (10 −5 M) was doubled compared with the basal level. This increase is similar to the data obtained from human atrial membranes (30). As expected, the increased β-AR density in the plasma membrane led to increase in cAMP production after stimulation with ISO in both cultured myocytes and transgenic mouse hearts overexpressing Rab4. However, Rab4 expression had no effect on the cAMP production in response to forskolin stimulation, suggesting that increased cAMP production in response to ISO by Rab4 expression is not due to the alteration of adenylyl cyclase activity. In addition, Rab4 expression had no effect on the expression of other molecules involved in β-AR signal regulation, including G proteins and Filipeanu et al

Cystic appearance of low-grade endometrial stromal sarcoma in the right atrium: case report

A 71-year-old woman presented with a right adnexal solid mass invading the right gonadal vein and inferior vena cava up to the hepatic veins revealed by CT and confirmed by MRI. A thin-walled cyst and a solid mass were unexpectedly found in the right atrium by transesophageal echocardiography (TEE) in the operating room. Using color Doppler and air bubbles as contrast material a circumscribed cyst was confirmed and localized close to the IVC. The cyst was connected to the mass in the inferior vena cava. The tumor, including the cyst, was removed without using cardiopulmonary bypass and described as a low-grade endometrial stromal sarcoma, a rare slowly growing tumor. This is the first TEE description of endometrial stromal sarcoma manifesting as a right atrial cyst

Image Texture Characterization Using the Discrete Orthonormal S-Transform

We present a new efficient approach for characterizing image texture based on a recently published discrete, orthonormal space-frequency transform known as the DOST. We develop a frequency-domain implementation of the DOST in two dimensions for the case of dyadic frequency sampling. Then, we describe a rapid and efficient approach to obtain local spatial frequency information for an image and show that this information can be used to characterize the horizontal and vertical frequency patterns in synthetic images. Finally, we demonstrate that DOST components can be combined to obtain a rotationally invariant set of texture features that can accurately classify a series of texture patterns. The DOST provides the computational efficiency and multi-scale information of wavelet transforms, while providing texture features in terms of Fourier frequencies. It outperforms leading wavelet-based texture analysis methods

Respiratory maneuvers in echocardiography: a review of clinical applications

During echocardiographic examination, respiration induces cyclic physiological changes of intracardiac haemodynamics, causing normal variations of the right and left ventricle Doppler inflows and outflows and physiological variation of extracardiac flows. The respiration related hemodynamic variation in intra and extracardiac flows may be utilized in the echocardiography laboratory to aid diagnosis in different pathological states. Nevertheless, physiologic respiratory phases can cause excessive translational motion of cardiac structures, lowering 2D image quality and interfering with optimal Doppler interrogation of flows or tissue motion

Decrease in shunt volume in patients with cryptogenic stroke and patent foramen ovale

<p>Abstract</p> <p>Background</p> <p>In patients with patent foramen ovale (PFO) there is evidence supporting the hypothesis of a change in right-to-left shunt (RLS) over time. Proven, this could have implications for the care of patients with PFO and a history of stroke. The following study addressed this hypothesis in a cohort of patients with stroke and PFO.</p> <p>Methods</p> <p>The RLS volume assessed during hospitalisation for stroke (index event/T0) was compared with the RLS volume on follow-up (T1) (median time between T0 and T1 was 10 months). In 102 patients with a history of stroke and PFO the RLS volume was re-assessed on follow-up using contrast-enhanced transcranial Doppler/duplex (ce-TCD) ultrasound. A change in RLS volume was defined as a difference of ≥20 microembolic signals (MES) or no evidence of RLS during ce-TCD ultrasound on follow-up.</p> <p>Results</p> <p>There was evidence of a marked reduction in RLS volume in 31/102 patients; in 14/31 patients a PFO was no longer detectable. An index event classified as cryptogenic stroke (P < 0.001; OD = 39.2, 95% confidence interval 6.0 to 258.2) and the time interval to the follow-up visit (P = 0.03) were independently associated with a change in RLS volume over time.</p> <p>Conclusions</p> <p>RLS volume across a PFO decreases over time, especially in patients with cryptogenic stroke. These may determine the development of new strategies for the management in the secondary stroke prevention.</p