Characterization of neglected Streptococcus suis pathotypes: molecular epidemiology and IdeSsuis-based vaccination approaches

Einleitung Streptococcus (S.) suis verursacht bei Schweinen unter anderem Meningitis, Arthritis, Serositis und Endokarditis und ist eine der größten Herausforderungen für die Schweineindustrie. Von 29 beschriebenen Serotypen sind die Serotypen 2, 7 und 9 unter invasiven Isolaten weltweit besonders prävalent, vor allem in Europa. Bis heute gibt es keinen zugelassenen Impfstoff zur Prävention von S. suis-Erkrankungen in Europa, daher ist im Feld die Anwendung stallspezifischer Impfstoffe verbreitet. Diese bieten jedoch höchstens homologen Schutz und ihre Wirkung kann durch prädisponierende Faktoren wie eine Infektion mit dem porcine reproductive and respiratory syndrome Virus (PRRSV) beeinträchtigt werden. Daher hat sich die Forschung auf Antigene fokussiert, die potentiell heterologen Schutz vermitteln. Zielstellung Ziele der Studie waren die Charakterisierung vernachlässigter invasiver S. suis Pathotypen der wichtigen Serotypen 7 und 9 und die Etablierung neuer Infektionsmodelle im Schwein. Des Weiteren sollte die immunogene und protektive Wirkung des Immunoglobulin (Ig) M-degradierenden Enzyms von S. suis, IdeSsuis, im Serotyp 9 Infektionsversuch untersucht werden. Material und Methoden In dieser Arbeit wurden in vitro Versuche und experimentelle Infektionen im Schwein durchgeführt. Dazu gehörte die Geno- und Phänotypisierung von 22 S. suis Serotyp 7 Stämmen und vier Serotyp 9 Stämmen. Die Genotypisierung erfolgte mittels multiplex (MP) Polymerase-Kettenreaktion (PCR), einer PCR zur Differenzierung verschiedener Genvarianten des muramidase-release protein (MRP) sowie mittels multilocus sequence typing (MLST). Zur Phänotypisierung der S. suis Stämme wurden bactericidal assays eingesetzt, die als Bakteriämiemodell fungierten. Auf diese Weise konnten die Empfänglichkeit gegenüber S. suis Stämmen sowie deren Virulenz beurteilt werden. Durch Zugabe von rekombinantem (r) IdeSsuis wurde die Rolle adaptiven IgMs in der Begrenzung der Bakteriämie untersucht. Anhand von Western Blot Analysen erfolgte die Untersuchung der Expression und Funktionalität von IdeSsuis sowie die Expression von MRP in S. suis Serotyp 7 Stämmen. Enzyme-linked immunosorbent assays (ELISA) kamen zum Einsatz, um die Entwicklung von IgM und IgG Spiegeln in Ferkeln im zeitlichen Verlauf und die IgG Spiegel nach rIdeSsuis Immunisierung zu messen. Durch rIdeSsuis Immunisierung induzierte Antigen-spezifische T-Helferzellen (Th-Zellen) wurden mithilfe der Durchflusszytometrie untersucht. Schließlich erfolgte die Durchführung zweier S. suis Serotyp 7 Etablierungsversuche mit je 18 bzw. 5 Ferkeln sowie zwei S. suis Serotyp 9 Impf- und Infektionsversuche mit je 18 Ferkeln. Sektionsproben wurden histologisch untersucht. In einem Fall wurde eine Endokarditis mittels fluorescence in situ hybridization (FISH) charakterisiert. Ergebnisse Die meisten untersuchten Serotyp 7 Stämme gehörten dem Sequenztyp (ST) 29 an, einem emerging pathotype in Europa. Trotz der engen phylogenetischen Verwandtschaft, war mrp in den Stämmen sehr variabel. Phänotypisch bildeten alle Stämme gleichermaßen eine kleine MRP Variante, MRPs. Für vier ausgewählte Serotyp 7 Stämme wurde die Expression von IdeSsuis gezeigt, jedoch mit Unterschieden in Größe und Funktionalität. Bactericidal assays dieser vier Stämme zeigten starke Proliferation im Blut von Absatzferkeln, aber Abtöten im Blut von Läuferschweinen aus zwei Herden mit unterschiedlichem S. suis Status. Dieses Überlebensmuster unterschied sich deutlich von dem eines Serotyp 9 Stammes. Durch Zugabe von rIdeSsuis, konnte gezeigt werden, dass das Abtöten der Serotyp 7 Stämme im Blut von Läuferschweinen des infizierten Bestandes IgM-vermittelt war. Unabhängig von der Herkunft entwickelten sich die IgM Spiegel in den Ferkeln im zeitlichen Verlauf fast synchron. Schließlich konnte die Virulenz eines Serotyp 7 Stammes in einem intravenösen Infektionsversuch mit 5 Ferkeln gezeigt werden. Alle Tiere entwickelten schwere Symptome einer S. suis Erkrankung. In einem Impf- und Infektionsversuch mit einem hoch virulenten Serotyp 9 Stamm wurde die immunogene und protektive Wirkung einer rIdeSsuis Immunisierung untersucht. Neun Ferkel wurden mit rIdeSsuis oder einem Placebo prime-boost-boost immunisiert und zwei Wochen später infiziert. Neunzig Prozent der Placebotiere entwickelten schwere Symptome einer S. suis Erkrankung und starben oder mussten aus Tierschutzgründen euthanasiert werden. Alle geimpften Tiere überlebten den Versuch, fielen jedoch mit Fieber und Lahmheiten auf. Es konnte also gezeigt werden, dass eine rIdeSsuis Immunisierung vor Mortalität, nicht aber Morbidität durch den Infektionsstamm schützt. Alle immunisierten Ferkel serokonvertierten und Antigen-spezifische Th-Zellen wurden nachgewiesen. Weder die IgG Antwort noch die Th-Zell Antwort wurde jedoch durch die Infektion verstärkt. In einem weiteren Impf- und Infektionsversuch mit einem anderen Serotyp 9 Stamm fiel ein Tier am 11. Tag nach der Infektion mit Zeichen einer akuten Leptomeningitis auf, nachdem es zuvor klinisch völlig unauffällig war. In der Sektion des Tieres wurde eine Endokarditis der Mitralklappe diagnostiziert, die mit Biofilm-Bildung assoziiert war, was mithilfe von Histologie und FISH gezeigt werden konnte. Zusätzlich wurde eine fibrinopurulente Leptomeningitis diagnostiziert. Das Ferkel hatte Antikörper gegen rIdeSsuis und tötete den Infektionsstamm ex vivo im Blut ab. Schlussfolgerungen In dieser Arbeit habe ich zwei wichtige S. suis Pathotypen charakterisiert: S. suis Serotyp 7 Stämme des ST29 und einen hoch virulenten Serotyp 9 Stamm vom ST94. Die Serotyp 7 Stämme stellten einen besonderen Pathotypen dar, bei dessen Bekämpfung IgM eine wichtige Rolle spielt. Bei einer Serotyp 9 Infektion konnten trotz des Abtötens der Bakterien im Blut und opsonisierender Antikörper Biofilmbildung und eine folgende akute Leptomeningitis nicht verhindert werden. Letztlich wurde Schutz vor einem hoch virulenten Serotyp 9 Stamm durch rIdeSsuis Immunisierung und damit zum ersten Mal für ein Antigen Protektion vor den wichtigen Serotypen 2 und 9 aufgezeigt. Dies ist ein vielversprechendes Ergebnis hinsichtlich der Entwicklung eines Impfstoffes gegen S. suis.Introduction Streptococcus (S.) suis causes meningitis, arthritis, serositis and endocarditis and is one of the biggest challenges for the swine industry. Of 29 described serotypes, the serotypes 2, 7 and 9 are highly prevalent amongst invasive S. suis isolates worldwide, especially in European countries. To date, no commercially produced vaccine is available in Europe for prevention of S. suis disease, thus the use of autogenous vaccines in the field is common. However, bacterins may at most confer homologous protection and their efficacy may be influenced by predisposing factors such as an infection with the porcine reproductive and respiratory syndrome virus (PRRSV). Research has therefore focused on subunit vaccines with the potential to elicit cross-protection against various serotypes. Aim of the study The objective of this study was to characterize neglected invasive S. suis pathotypes of the important serotypes 7 and 9 and to establish infection models in the main host of S. suis, the pig. A further aim was to investigate immunogenicities and protective efficacies of the immunoglobulin (Ig) M-degrading enzyme of S. suis, IdeSsuis, in a serotype 9 challenge experiment. Materials and methods In vitro experiments and experimental challenges in swine were conducted as part of this thesis. This included the geno- and phenotyping of 22 S. suis serotype 7 strains and four serotype 9 strains. Genotyping was conducted using a multiplex (MP) polymerase chain reaction (PCR), a PCR for differentiation of variants of the muramidase-released protein (MRP) gene and multilocus sequence typing (MLST). For phenotyping of the S. suis strains, bactericidal assays were carried out which served as a model for bacteraemia. This way, susceptibility to S. suis strains and virulence of different strains was assessed. Further, through addition of recombinant (r) IdeSsuis, the role of adaptive IgM in limiting bacteraemia was elucidated. Western blot analyses were conducted to investigate expression and functionality of IdeSsuis as well as expression of MRP in S. suis serotype 7 strains. Enzyme-linked immunosorbent assays (ELISA) were used to determine the development of IgM and IgG levels in piglets over time and to assess IgG levels following rIdeSsuis immunization. Antigen-reactive T-helper (h) cells induced by rIdeSsuis immunization were investigated using flow cytometry. Finally, two experiments to establish a serotype 7 infection model with 18 and 5 piglets each and two vaccination and challenge experiments using different S. suis serotype 9 strains (n=18 piglets/ experiment) were conducted. Samples of dissected animals were examined histologically. In one case, an endocarditis was analysed using fluorescence in situ hybridization (FISH). Results Most of the investigated serotype 7 strains belonged to sequence type (ST) 29 which was thus shown to be an emerging pathotype in Europe. Despite the close phylogenetic relation of the strains, mrp was highly variable. Phenotypically, all strains expressed a small variant of MRP, MRPs. Four selected serotype 7 strains were shown to express IdeSsuis with differences in size and functionality. Bactericidal assays of these four strains revealed high proliferation in blood of weaning piglets but killing in blood of growing piglets of two herds which differed in their S. suis infection status. This survival pattern was distinct from a serotype 9 strain. Addition of rIdeSsuis revealed that killing of the serotype 7 strains in blood of growing piglets of the infected herd was IgM-mediated. Independent of the originating herd, IgM levels of the piglets rose almost synchronous over time. Finally, the virulence of a serotype 7 strain was proven in an intravenous challenge experiment with five pigs which all developed severe clinical signs of S. suis disease. In a vaccination and challenge experiment using a highly virulent serotype 9 strain, immunogenicities and protective efficacies of rIdeSsuis immunization were investigated. Nine piglets were prime-boost-boost vaccinated with rIdeSsuis or placebo-treated and challenged two weeks later. Ninety per cent of the placebo-treated piglets developed severe clinical signs of S. suis disease and died or had to be euthanized due to animal welfare reasons. All vaccinated piglets survived the experiment, however elevated body temperatures and lameness were also noted in this group. Accordingly, rIdeSsuis vaccination protected from mortality but not morbidity caused by the challenge strain. Seroconversion of the immunized piglets and antigen-reactive Th cells were detected. Neither the IgG response nor the Th cell response was boosted through the challenge. In a further vaccination and challenge experiment with a different serotype 9 strain, one animal was clinically unobtrusive following infection and then developed an acute leptomeningitis on the 11th day post infection and had to be euthanized. Dissection of the animal revealed an endocarditis on the mitral valve which was proven to be associated with biofilm formation by histology and FISH. In addition, a fibrinosuppurative leptomeningitis was diagnosed. The piglet had specific antibodies against rIdeSsuis and mediated killing of the challenge strain in a bactericidal assay. Conclusions In this thesis, I characterized two important pathotypes: S. suis serotype 7 strains of ST29 and a highly virulent serotype 9 strain of ST94. The serotype 7 strains represent a distinct pathotype and IgM plays a significant role in their control. Following a serotype 9 infection, biofilm formation and a subsequent acute leptomeningitis could not be prevented despite blood bactericidal activity and opsonizing antibodies. Finally, protection against challenge with a highly virulent serotype 9 strain through rIdeSsuis immunization was demonstrated. Thereby, for the first time an antigen was shown to confer cross-protection against the important serotypes 2 and 9, which is highly encouraging regarding the development of a vaccine against S. suis

Characterization of neglected Streptococcus suis pathotypes: molecular epidemiology and IdeSsuis-based vaccination approaches

Einleitung Streptococcus (S.) suis verursacht bei Schweinen unter anderem Meningitis, Arthritis, Serositis und Endokarditis und ist eine der größten Herausforderungen für die Schweineindustrie. Von 29 beschriebenen Serotypen sind die Serotypen 2, 7 und 9 unter invasiven Isolaten weltweit besonders prävalent, vor allem in Europa. Bis heute gibt es keinen zugelassenen Impfstoff zur Prävention von S. suis-Erkrankungen in Europa, daher ist im Feld die Anwendung stallspezifischer Impfstoffe verbreitet. Diese bieten jedoch höchstens homologen Schutz und ihre Wirkung kann durch prädisponierende Faktoren wie eine Infektion mit dem porcine reproductive and respiratory syndrome Virus (PRRSV) beeinträchtigt werden. Daher hat sich die Forschung auf Antigene fokussiert, die potentiell heterologen Schutz vermitteln. Zielstellung Ziele der Studie waren die Charakterisierung vernachlässigter invasiver S. suis Pathotypen der wichtigen Serotypen 7 und 9 und die Etablierung neuer Infektionsmodelle im Schwein. Des Weiteren sollte die immunogene und protektive Wirkung des Immunoglobulin (Ig) M-degradierenden Enzyms von S. suis, IdeSsuis, im Serotyp 9 Infektionsversuch untersucht werden. Material und Methoden In dieser Arbeit wurden in vitro Versuche und experimentelle Infektionen im Schwein durchgeführt. Dazu gehörte die Geno- und Phänotypisierung von 22 S. suis Serotyp 7 Stämmen und vier Serotyp 9 Stämmen. Die Genotypisierung erfolgte mittels multiplex (MP) Polymerase-Kettenreaktion (PCR), einer PCR zur Differenzierung verschiedener Genvarianten des muramidase-release protein (MRP) sowie mittels multilocus sequence typing (MLST). Zur Phänotypisierung der S. suis Stämme wurden bactericidal assays eingesetzt, die als Bakteriämiemodell fungierten. Auf diese Weise konnten die Empfänglichkeit gegenüber S. suis Stämmen sowie deren Virulenz beurteilt werden. Durch Zugabe von rekombinantem (r) IdeSsuis wurde die Rolle adaptiven IgMs in der Begrenzung der Bakteriämie untersucht. Anhand von Western Blot Analysen erfolgte die Untersuchung der Expression und Funktionalität von IdeSsuis sowie die Expression von MRP in S. suis Serotyp 7 Stämmen. Enzyme-linked immunosorbent assays (ELISA) kamen zum Einsatz, um die Entwicklung von IgM und IgG Spiegeln in Ferkeln im zeitlichen Verlauf und die IgG Spiegel nach rIdeSsuis Immunisierung zu messen. Durch rIdeSsuis Immunisierung induzierte Antigen-spezifische T-Helferzellen (Th-Zellen) wurden mithilfe der Durchflusszytometrie untersucht. Schließlich erfolgte die Durchführung zweier S. suis Serotyp 7 Etablierungsversuche mit je 18 bzw. 5 Ferkeln sowie zwei S. suis Serotyp 9 Impf- und Infektionsversuche mit je 18 Ferkeln. Sektionsproben wurden histologisch untersucht. In einem Fall wurde eine Endokarditis mittels fluorescence in situ hybridization (FISH) charakterisiert. Ergebnisse Die meisten untersuchten Serotyp 7 Stämme gehörten dem Sequenztyp (ST) 29 an, einem emerging pathotype in Europa. Trotz der engen phylogenetischen Verwandtschaft, war mrp in den Stämmen sehr variabel. Phänotypisch bildeten alle Stämme gleichermaßen eine kleine MRP Variante, MRPs. Für vier ausgewählte Serotyp 7 Stämme wurde die Expression von IdeSsuis gezeigt, jedoch mit Unterschieden in Größe und Funktionalität. Bactericidal assays dieser vier Stämme zeigten starke Proliferation im Blut von Absatzferkeln, aber Abtöten im Blut von Läuferschweinen aus zwei Herden mit unterschiedlichem S. suis Status. Dieses Überlebensmuster unterschied sich deutlich von dem eines Serotyp 9 Stammes. Durch Zugabe von rIdeSsuis, konnte gezeigt werden, dass das Abtöten der Serotyp 7 Stämme im Blut von Läuferschweinen des infizierten Bestandes IgM-vermittelt war. Unabhängig von der Herkunft entwickelten sich die IgM Spiegel in den Ferkeln im zeitlichen Verlauf fast synchron. Schließlich konnte die Virulenz eines Serotyp 7 Stammes in einem intravenösen Infektionsversuch mit 5 Ferkeln gezeigt werden. Alle Tiere entwickelten schwere Symptome einer S. suis Erkrankung. In einem Impf- und Infektionsversuch mit einem hoch virulenten Serotyp 9 Stamm wurde die immunogene und protektive Wirkung einer rIdeSsuis Immunisierung untersucht. Neun Ferkel wurden mit rIdeSsuis oder einem Placebo prime-boost-boost immunisiert und zwei Wochen später infiziert. Neunzig Prozent der Placebotiere entwickelten schwere Symptome einer S. suis Erkrankung und starben oder mussten aus Tierschutzgründen euthanasiert werden. Alle geimpften Tiere überlebten den Versuch, fielen jedoch mit Fieber und Lahmheiten auf. Es konnte also gezeigt werden, dass eine rIdeSsuis Immunisierung vor Mortalität, nicht aber Morbidität durch den Infektionsstamm schützt. Alle immunisierten Ferkel serokonvertierten und Antigen-spezifische Th-Zellen wurden nachgewiesen. Weder die IgG Antwort noch die Th-Zell Antwort wurde jedoch durch die Infektion verstärkt. In einem weiteren Impf- und Infektionsversuch mit einem anderen Serotyp 9 Stamm fiel ein Tier am 11. Tag nach der Infektion mit Zeichen einer akuten Leptomeningitis auf, nachdem es zuvor klinisch völlig unauffällig war. In der Sektion des Tieres wurde eine Endokarditis der Mitralklappe diagnostiziert, die mit Biofilm-Bildung assoziiert war, was mithilfe von Histologie und FISH gezeigt werden konnte. Zusätzlich wurde eine fibrinopurulente Leptomeningitis diagnostiziert. Das Ferkel hatte Antikörper gegen rIdeSsuis und tötete den Infektionsstamm ex vivo im Blut ab. Schlussfolgerungen In dieser Arbeit habe ich zwei wichtige S. suis Pathotypen charakterisiert: S. suis Serotyp 7 Stämme des ST29 und einen hoch virulenten Serotyp 9 Stamm vom ST94. Die Serotyp 7 Stämme stellten einen besonderen Pathotypen dar, bei dessen Bekämpfung IgM eine wichtige Rolle spielt. Bei einer Serotyp 9 Infektion konnten trotz des Abtötens der Bakterien im Blut und opsonisierender Antikörper Biofilmbildung und eine folgende akute Leptomeningitis nicht verhindert werden. Letztlich wurde Schutz vor einem hoch virulenten Serotyp 9 Stamm durch rIdeSsuis Immunisierung und damit zum ersten Mal für ein Antigen Protektion vor den wichtigen Serotypen 2 und 9 aufgezeigt. Dies ist ein vielversprechendes Ergebnis hinsichtlich der Entwicklung eines Impfstoffes gegen S. suis.Introduction Streptococcus (S.) suis causes meningitis, arthritis, serositis and endocarditis and is one of the biggest challenges for the swine industry. Of 29 described serotypes, the serotypes 2, 7 and 9 are highly prevalent amongst invasive S. suis isolates worldwide, especially in European countries. To date, no commercially produced vaccine is available in Europe for prevention of S. suis disease, thus the use of autogenous vaccines in the field is common. However, bacterins may at most confer homologous protection and their efficacy may be influenced by predisposing factors such as an infection with the porcine reproductive and respiratory syndrome virus (PRRSV). Research has therefore focused on subunit vaccines with the potential to elicit cross-protection against various serotypes. Aim of the study The objective of this study was to characterize neglected invasive S. suis pathotypes of the important serotypes 7 and 9 and to establish infection models in the main host of S. suis, the pig. A further aim was to investigate immunogenicities and protective efficacies of the immunoglobulin (Ig) M-degrading enzyme of S. suis, IdeSsuis, in a serotype 9 challenge experiment. Materials and methods In vitro experiments and experimental challenges in swine were conducted as part of this thesis. This included the geno- and phenotyping of 22 S. suis serotype 7 strains and four serotype 9 strains. Genotyping was conducted using a multiplex (MP) polymerase chain reaction (PCR), a PCR for differentiation of variants of the muramidase-released protein (MRP) gene and multilocus sequence typing (MLST). For phenotyping of the S. suis strains, bactericidal assays were carried out which served as a model for bacteraemia. This way, susceptibility to S. suis strains and virulence of different strains was assessed. Further, through addition of recombinant (r) IdeSsuis, the role of adaptive IgM in limiting bacteraemia was elucidated. Western blot analyses were conducted to investigate expression and functionality of IdeSsuis as well as expression of MRP in S. suis serotype 7 strains. Enzyme-linked immunosorbent assays (ELISA) were used to determine the development of IgM and IgG levels in piglets over time and to assess IgG levels following rIdeSsuis immunization. Antigen-reactive T-helper (h) cells induced by rIdeSsuis immunization were investigated using flow cytometry. Finally, two experiments to establish a serotype 7 infection model with 18 and 5 piglets each and two vaccination and challenge experiments using different S. suis serotype 9 strains (n=18 piglets/ experiment) were conducted. Samples of dissected animals were examined histologically. In one case, an endocarditis was analysed using fluorescence in situ hybridization (FISH). Results Most of the investigated serotype 7 strains belonged to sequence type (ST) 29 which was thus shown to be an emerging pathotype in Europe. Despite the close phylogenetic relation of the strains, mrp was highly variable. Phenotypically, all strains expressed a small variant of MRP, MRPs. Four selected serotype 7 strains were shown to express IdeSsuis with differences in size and functionality. Bactericidal assays of these four strains revealed high proliferation in blood of weaning piglets but killing in blood of growing piglets of two herds which differed in their S. suis infection status. This survival pattern was distinct from a serotype 9 strain. Addition of rIdeSsuis revealed that killing of the serotype 7 strains in blood of growing piglets of the infected herd was IgM-mediated. Independent of the originating herd, IgM levels of the piglets rose almost synchronous over time. Finally, the virulence of a serotype 7 strain was proven in an intravenous challenge experiment with five pigs which all developed severe clinical signs of S. suis disease. In a vaccination and challenge experiment using a highly virulent serotype 9 strain, immunogenicities and protective efficacies of rIdeSsuis immunization were investigated. Nine piglets were prime-boost-boost vaccinated with rIdeSsuis or placebo-treated and challenged two weeks later. Ninety per cent of the placebo-treated piglets developed severe clinical signs of S. suis disease and died or had to be euthanized due to animal welfare reasons. All vaccinated piglets survived the experiment, however elevated body temperatures and lameness were also noted in this group. Accordingly, rIdeSsuis vaccination protected from mortality but not morbidity caused by the challenge strain. Seroconversion of the immunized piglets and antigen-reactive Th cells were detected. Neither the IgG response nor the Th cell response was boosted through the challenge. In a further vaccination and challenge experiment with a different serotype 9 strain, one animal was clinically unobtrusive following infection and then developed an acute leptomeningitis on the 11th day post infection and had to be euthanized. Dissection of the animal revealed an endocarditis on the mitral valve which was proven to be associated with biofilm formation by histology and FISH. In addition, a fibrinosuppurative leptomeningitis was diagnosed. The piglet had specific antibodies against rIdeSsuis and mediated killing of the challenge strain in a bactericidal assay. Conclusions In this thesis, I characterized two important pathotypes: S. suis serotype 7 strains of ST29 and a highly virulent serotype 9 strain of ST94. The serotype 7 strains represent a distinct pathotype and IgM plays a significant role in their control. Following a serotype 9 infection, biofilm formation and a subsequent acute leptomeningitis could not be prevented despite blood bactericidal activity and opsonizing antibodies. Finally, protection against challenge with a highly virulent serotype 9 strain through rIdeSsuis immunization was demonstrated. Thereby, for the first time an antigen was shown to confer cross-protection against the important serotypes 2 and 9, which is highly encouraging regarding the development of a vaccine against S. suis

Characterization of neglected Streptococcus suis pathotypes: molecular epidemiology and IdeSsuis-based vaccination approaches

Einleitung Streptococcus (S.) suis verursacht bei Schweinen unter anderem Meningitis, Arthritis, Serositis und Endokarditis und ist eine der größten Herausforderungen für die Schweineindustrie. Von 29 beschriebenen Serotypen sind die Serotypen 2, 7 und 9 unter invasiven Isolaten weltweit besonders prävalent, vor allem in Europa. Bis heute gibt es keinen zugelassenen Impfstoff zur Prävention von S. suis-Erkrankungen in Europa, daher ist im Feld die Anwendung stallspezifischer Impfstoffe verbreitet. Diese bieten jedoch höchstens homologen Schutz und ihre Wirkung kann durch prädisponierende Faktoren wie eine Infektion mit dem porcine reproductive and respiratory syndrome Virus (PRRSV) beeinträchtigt werden. Daher hat sich die Forschung auf Antigene fokussiert, die potentiell heterologen Schutz vermitteln. Zielstellung Ziele der Studie waren die Charakterisierung vernachlässigter invasiver S. suis Pathotypen der wichtigen Serotypen 7 und 9 und die Etablierung neuer Infektionsmodelle im Schwein. Des Weiteren sollte die immunogene und protektive Wirkung des Immunoglobulin (Ig) M-degradierenden Enzyms von S. suis, IdeSsuis, im Serotyp 9 Infektionsversuch untersucht werden. Material und Methoden In dieser Arbeit wurden in vitro Versuche und experimentelle Infektionen im Schwein durchgeführt. Dazu gehörte die Geno- und Phänotypisierung von 22 S. suis Serotyp 7 Stämmen und vier Serotyp 9 Stämmen. Die Genotypisierung erfolgte mittels multiplex (MP) Polymerase-Kettenreaktion (PCR), einer PCR zur Differenzierung verschiedener Genvarianten des muramidase-release protein (MRP) sowie mittels multilocus sequence typing (MLST). Zur Phänotypisierung der S. suis Stämme wurden bactericidal assays eingesetzt, die als Bakteriämiemodell fungierten. Auf diese Weise konnten die Empfänglichkeit gegenüber S. suis Stämmen sowie deren Virulenz beurteilt werden. Durch Zugabe von rekombinantem (r) IdeSsuis wurde die Rolle adaptiven IgMs in der Begrenzung der Bakteriämie untersucht. Anhand von Western Blot Analysen erfolgte die Untersuchung der Expression und Funktionalität von IdeSsuis sowie die Expression von MRP in S. suis Serotyp 7 Stämmen. Enzyme-linked immunosorbent assays (ELISA) kamen zum Einsatz, um die Entwicklung von IgM und IgG Spiegeln in Ferkeln im zeitlichen Verlauf und die IgG Spiegel nach rIdeSsuis Immunisierung zu messen. Durch rIdeSsuis Immunisierung induzierte Antigen-spezifische T-Helferzellen (Th-Zellen) wurden mithilfe der Durchflusszytometrie untersucht. Schließlich erfolgte die Durchführung zweier S. suis Serotyp 7 Etablierungsversuche mit je 18 bzw. 5 Ferkeln sowie zwei S. suis Serotyp 9 Impf- und Infektionsversuche mit je 18 Ferkeln. Sektionsproben wurden histologisch untersucht. In einem Fall wurde eine Endokarditis mittels fluorescence in situ hybridization (FISH) charakterisiert. Ergebnisse Die meisten untersuchten Serotyp 7 Stämme gehörten dem Sequenztyp (ST) 29 an, einem emerging pathotype in Europa. Trotz der engen phylogenetischen Verwandtschaft, war mrp in den Stämmen sehr variabel. Phänotypisch bildeten alle Stämme gleichermaßen eine kleine MRP Variante, MRPs. Für vier ausgewählte Serotyp 7 Stämme wurde die Expression von IdeSsuis gezeigt, jedoch mit Unterschieden in Größe und Funktionalität. Bactericidal assays dieser vier Stämme zeigten starke Proliferation im Blut von Absatzferkeln, aber Abtöten im Blut von Läuferschweinen aus zwei Herden mit unterschiedlichem S. suis Status. Dieses Überlebensmuster unterschied sich deutlich von dem eines Serotyp 9 Stammes. Durch Zugabe von rIdeSsuis, konnte gezeigt werden, dass das Abtöten der Serotyp 7 Stämme im Blut von Läuferschweinen des infizierten Bestandes IgM-vermittelt war. Unabhängig von der Herkunft entwickelten sich die IgM Spiegel in den Ferkeln im zeitlichen Verlauf fast synchron. Schließlich konnte die Virulenz eines Serotyp 7 Stammes in einem intravenösen Infektionsversuch mit 5 Ferkeln gezeigt werden. Alle Tiere entwickelten schwere Symptome einer S. suis Erkrankung. In einem Impf- und Infektionsversuch mit einem hoch virulenten Serotyp 9 Stamm wurde die immunogene und protektive Wirkung einer rIdeSsuis Immunisierung untersucht. Neun Ferkel wurden mit rIdeSsuis oder einem Placebo prime-boost-boost immunisiert und zwei Wochen später infiziert. Neunzig Prozent der Placebotiere entwickelten schwere Symptome einer S. suis Erkrankung und starben oder mussten aus Tierschutzgründen euthanasiert werden. Alle geimpften Tiere überlebten den Versuch, fielen jedoch mit Fieber und Lahmheiten auf. Es konnte also gezeigt werden, dass eine rIdeSsuis Immunisierung vor Mortalität, nicht aber Morbidität durch den Infektionsstamm schützt. Alle immunisierten Ferkel serokonvertierten und Antigen-spezifische Th-Zellen wurden nachgewiesen. Weder die IgG Antwort noch die Th-Zell Antwort wurde jedoch durch die Infektion verstärkt. In einem weiteren Impf- und Infektionsversuch mit einem anderen Serotyp 9 Stamm fiel ein Tier am 11. Tag nach der Infektion mit Zeichen einer akuten Leptomeningitis auf, nachdem es zuvor klinisch völlig unauffällig war. In der Sektion des Tieres wurde eine Endokarditis der Mitralklappe diagnostiziert, die mit Biofilm-Bildung assoziiert war, was mithilfe von Histologie und FISH gezeigt werden konnte. Zusätzlich wurde eine fibrinopurulente Leptomeningitis diagnostiziert. Das Ferkel hatte Antikörper gegen rIdeSsuis und tötete den Infektionsstamm ex vivo im Blut ab. Schlussfolgerungen In dieser Arbeit habe ich zwei wichtige S. suis Pathotypen charakterisiert: S. suis Serotyp 7 Stämme des ST29 und einen hoch virulenten Serotyp 9 Stamm vom ST94. Die Serotyp 7 Stämme stellten einen besonderen Pathotypen dar, bei dessen Bekämpfung IgM eine wichtige Rolle spielt. Bei einer Serotyp 9 Infektion konnten trotz des Abtötens der Bakterien im Blut und opsonisierender Antikörper Biofilmbildung und eine folgende akute Leptomeningitis nicht verhindert werden. Letztlich wurde Schutz vor einem hoch virulenten Serotyp 9 Stamm durch rIdeSsuis Immunisierung und damit zum ersten Mal für ein Antigen Protektion vor den wichtigen Serotypen 2 und 9 aufgezeigt. Dies ist ein vielversprechendes Ergebnis hinsichtlich der Entwicklung eines Impfstoffes gegen S. suis.Introduction Streptococcus (S.) suis causes meningitis, arthritis, serositis and endocarditis and is one of the biggest challenges for the swine industry. Of 29 described serotypes, the serotypes 2, 7 and 9 are highly prevalent amongst invasive S. suis isolates worldwide, especially in European countries. To date, no commercially produced vaccine is available in Europe for prevention of S. suis disease, thus the use of autogenous vaccines in the field is common. However, bacterins may at most confer homologous protection and their efficacy may be influenced by predisposing factors such as an infection with the porcine reproductive and respiratory syndrome virus (PRRSV). Research has therefore focused on subunit vaccines with the potential to elicit cross-protection against various serotypes. Aim of the study The objective of this study was to characterize neglected invasive S. suis pathotypes of the important serotypes 7 and 9 and to establish infection models in the main host of S. suis, the pig. A further aim was to investigate immunogenicities and protective efficacies of the immunoglobulin (Ig) M-degrading enzyme of S. suis, IdeSsuis, in a serotype 9 challenge experiment. Materials and methods In vitro experiments and experimental challenges in swine were conducted as part of this thesis. This included the geno- and phenotyping of 22 S. suis serotype 7 strains and four serotype 9 strains. Genotyping was conducted using a multiplex (MP) polymerase chain reaction (PCR), a PCR for differentiation of variants of the muramidase-released protein (MRP) gene and multilocus sequence typing (MLST). For phenotyping of the S. suis strains, bactericidal assays were carried out which served as a model for bacteraemia. This way, susceptibility to S. suis strains and virulence of different strains was assessed. Further, through addition of recombinant (r) IdeSsuis, the role of adaptive IgM in limiting bacteraemia was elucidated. Western blot analyses were conducted to investigate expression and functionality of IdeSsuis as well as expression of MRP in S. suis serotype 7 strains. Enzyme-linked immunosorbent assays (ELISA) were used to determine the development of IgM and IgG levels in piglets over time and to assess IgG levels following rIdeSsuis immunization. Antigen-reactive T-helper (h) cells induced by rIdeSsuis immunization were investigated using flow cytometry. Finally, two experiments to establish a serotype 7 infection model with 18 and 5 piglets each and two vaccination and challenge experiments using different S. suis serotype 9 strains (n=18 piglets/ experiment) were conducted. Samples of dissected animals were examined histologically. In one case, an endocarditis was analysed using fluorescence in situ hybridization (FISH). Results Most of the investigated serotype 7 strains belonged to sequence type (ST) 29 which was thus shown to be an emerging pathotype in Europe. Despite the close phylogenetic relation of the strains, mrp was highly variable. Phenotypically, all strains expressed a small variant of MRP, MRPs. Four selected serotype 7 strains were shown to express IdeSsuis with differences in size and functionality. Bactericidal assays of these four strains revealed high proliferation in blood of weaning piglets but killing in blood of growing piglets of two herds which differed in their S. suis infection status. This survival pattern was distinct from a serotype 9 strain. Addition of rIdeSsuis revealed that killing of the serotype 7 strains in blood of growing piglets of the infected herd was IgM-mediated. Independent of the originating herd, IgM levels of the piglets rose almost synchronous over time. Finally, the virulence of a serotype 7 strain was proven in an intravenous challenge experiment with five pigs which all developed severe clinical signs of S. suis disease. In a vaccination and challenge experiment using a highly virulent serotype 9 strain, immunogenicities and protective efficacies of rIdeSsuis immunization were investigated. Nine piglets were prime-boost-boost vaccinated with rIdeSsuis or placebo-treated and challenged two weeks later. Ninety per cent of the placebo-treated piglets developed severe clinical signs of S. suis disease and died or had to be euthanized due to animal welfare reasons. All vaccinated piglets survived the experiment, however elevated body temperatures and lameness were also noted in this group. Accordingly, rIdeSsuis vaccination protected from mortality but not morbidity caused by the challenge strain. Seroconversion of the immunized piglets and antigen-reactive Th cells were detected. Neither the IgG response nor the Th cell response was boosted through the challenge. In a further vaccination and challenge experiment with a different serotype 9 strain, one animal was clinically unobtrusive following infection and then developed an acute leptomeningitis on the 11th day post infection and had to be euthanized. Dissection of the animal revealed an endocarditis on the mitral valve which was proven to be associated with biofilm formation by histology and FISH. In addition, a fibrinosuppurative leptomeningitis was diagnosed. The piglet had specific antibodies against rIdeSsuis and mediated killing of the challenge strain in a bactericidal assay. Conclusions In this thesis, I characterized two important pathotypes: S. suis serotype 7 strains of ST29 and a highly virulent serotype 9 strain of ST94. The serotype 7 strains represent a distinct pathotype and IgM plays a significant role in their control. Following a serotype 9 infection, biofilm formation and a subsequent acute leptomeningitis could not be prevented despite blood bactericidal activity and opsonizing antibodies. Finally, protection against challenge with a highly virulent serotype 9 strain through rIdeSsuis immunization was demonstrated. Thereby, for the first time an antigen was shown to confer cross-protection against the important serotypes 2 and 9, which is highly encouraging regarding the development of a vaccine against S. suis

A critical review on experimental Streptococcus suis infection in pigs with a focus on clinical monitoring and refinement strategies

Abstract Streptococcus suis (S. suis) is a major pig pathogen worldwide with zoonotic potential. Though different research groups have contributed to a better understanding of the pathogenesis of S. suis infections in recent years, there are still numerous neglected research topics requiring animal infection trials. Of note, animal experiments are crucial to develop a cross-protective vaccine which is highly needed in the field. Due to the severe clinical signs associated with S. suis pathologies such as meningitis and arthritis, implementation of refinement is very important to reduce pain and distress of experimentally infected pigs. This review highlights the great diversity of clinical signs and courses of disease after experimental S. suis pig infections. We review clinical read out parameters and refinement strategies in experimental S. suis pig infections published between 2000 and 2021. Currently, substantial differences exist in describing clinical monitoring and humane endpoints. Most of the reviewed studies set the body temperature threshold of fever as high as 40.5°C. Monitoring intervals vary mainly between daily, twice a day and three times a day. Only a few studies apply scoring systems. Published scoring systems are inconsistent in their inclusion of parameters such as body temperature, feeding behavior, and respiratory signs. Locomotion and central nervous system signs are more common clinical scoring parameters in different studies by various research groups. As the heterogenicity in clinical monitoring limits the comparability between studies we hope to initiate a discussion with this review leading to an agreement on clinical read out parameters and monitoring intervals among S. suis research groups

Streptococcus suis cps7: an emerging virulent sequence type (ST29) shows a distinct, IgM-determined pattern of bacterial survival in blood of piglets during the early adaptive immune response after weaning

Abstract Streptococcus (S.) suis is an important porcine pathogen causing meningitis, arthritis and septicemia. As cps7 emerged recently in Germany in association with severe herd problems, the objective of this study was to characterize the geno- and phenotype of invasive cps7 strains. Twenty cps7 strains were isolated from diseased pigs from different farms with S. suis herd problems due to meningitis and other pathologies. Eighteen of the cps7 isolates belonged to sequence type (ST) 29. Most of these cps7 strains secreted a short MRP variant in agreement with a premature stop codon. Expression of Ide Ssuis , an IgM specific protease, was variable in four further investigated cps7 ST29 isolates. Bactericidal assays revealed very high survival factors of these four cps7 ST29 strains in the blood of weaning piglets. In growing piglets, the increase of specific IgM led to efficient killing of cps7 ST29 as shown by addition of the IgM protease Ide Ssuis . Finally, virulence of a cps7 ST29 strain was confirmed in experimental infection of weaning piglets leading to meningitis and arthritis. In conclusion, this study characterizes cps7 ST29 as a distinct S. suis pathotype showing high survival factors in porcine blood after weaning, but IgM-mediated killing in the blood of older growing piglets. This underlines the relevance of IgM as an important host defense mechanism against S. suis

MOESM5 of Streptococcus suis cps7: an emerging virulent sequence type (ST29) shows a distinct, IgM-determined pattern of bacterial survival in blood of piglets during the early adaptive immune response after weaning

Additional file 5. Scoring of fibrinosuppurative lesions of piglets challenged with S.suis cps7 strain 13-00283-02 (mrp+ cps7). Five spf piglets were infected intravenously with 2 × 108 CFU of S. suis cps7 ST29 strain 13-00283-02 and afterwards monitored every 8 h. All piglets demonstrated clinical signs in relation to polyarthritis (lameness, swollen joints, pain vocalization) and/or central nervous system dysfunctions (opisthotonus, ataxia, generalized tremor) within 36 h post-infection and were euthanized for animal welfare reasons. Necropsies and histopathological screenings of the indicated tissues were conducted with all 5 piglets as described [28]

MOESM1 of Streptococcus suis cps7: an emerging virulent sequence type (ST29) shows a distinct, IgM-determined pattern of bacterial survival in blood of piglets during the early adaptive immune response after weaning

Additional file 1. Sequences of oligonucleotide primers. Name, sequence and position of primer sequences used for mrp sequencing

MOESM4 of Streptococcus suis cps7: an emerging virulent sequence type (ST29) shows a distinct, IgM-determined pattern of bacterial survival in blood of piglets during the early adaptive immune response after weaning

Additional file 4. Titers of serum IgM antibodies binding to the unencapsulated strain 10cpsΔEF increase in the five investigated cps7 free piglets from 4.5 to 6.5 weeks of age. The unencapsulated mutant 10cpsΔEF of cps2 strain 10 was used as antigen in an ELISA for determination of IgM antibodies binding to other S. suis antigens but capsular polysaccharides in the 5 piglets investigated for the data presented in Figure 5, which were from a herd considered free of cps7 and cps9. Means and standard deviations are indicated by horizontal lines and error bars, respectively. Each symbol represents a different animal. Differences were not significant using a two-tailed paired t-test

MOESM2 of Streptococcus suis cps7: an emerging virulent sequence type (ST29) shows a distinct, IgM-determined pattern of bacterial survival in blood of piglets during the early adaptive immune response after weaning

Additional file 2. Detection of ide Ssuis in different S. suis cps7 strains via PCR. Primers that bind in the conserved region of ide Ssuis (IdeSsuis_con_fo: GGGGAAGTAGCGGTAGAGATGAAAG and IdeSsuis_con_re: GATTGACACCGCCCTGTGCC) were used for amplification of ide Ssuis in cps7 strains #451, 13-00283-02, V2310/1 and D14412/3. Strain 10 served as positive and 10∆ide Ssuis as negative reference strains. MW, 100 bp plus ladder (Invitrogen). Sizes of selected marker bands (in base pairs) are indicated on the left

Proline-rich antimicrobial peptide Api137 is bactericidal in porcine blood infected ex vivo with a porcine or human Klebsiella pneumoniae strain

Objectives: Klebsiella pneumoniae is an emerging invasive pathogen in humans and pigs. Resistance against multiple antibiotics in this species is a major health concern and the development of new antibiotics is urgently needed. The objective of this study was to investigate the effects of proline-rich antimicrobial peptides (PrAMPs) on the survival of K. pneumoniae strains in porcine blood. Methods: We established a bactericidal assay with K. pneumoniae in fresh blood drawn from 4-week-old piglets. PrAMPs, namely the apidaecins Api137 and Api802 as well as the oncocin Onc112, were added to ex vivo-infected whole blood samples in order to study their bactericidal effects and, in the case of Api137, also immune responses. Results: A porcine invasive and a human iucA+rmpA+ K. pneumoniae strain showed prominent proliferation in porcine blood. Application of Api137 resulted in a dose-dependent prominent bactericidal effect killing the invasive porcine K. pneumoniae strain. Addition of 8 μg/mL Api137 also resulted in complete killing of the human iucA+rmpA+ strain. Cytotoxicity, haemolysis and induction of the pro-inflammatory cytokine tumour necrosis factor-alpha (TNFα) in K. pneumoniae-infected porcine blood treated with Api137 was comparable with values obtained after application of 10 μg/mL cefquinome. Conclusion: We describe a new non-rodent model for invasive K. pneumoniae bacteraemia and present promising data for the PrAMP Api137 for the control of infection with hypervirulent K. pneumoniae strains