High-Integrity Performance Monitoring Units in Automotive Chips for Reliable Timing V&V

As software continues to control more system-critical functions in cars, its timing is becoming an integral element in functional safety. Timing validation and verification (V&V) assesses softwares end-to-end timing measurements against given budgets. The advent of multicore processors with massive resource sharing reduces the significance of end-to-end execution times for timing V&V and requires reasoning on (worst-case) access delays on contention-prone hardware resources. While Performance Monitoring Units (PMU) support this finer-grained reasoning, their design has never been a prime consideration in high-performance processors - where automotive-chips PMU implementations descend from - since PMU does not directly affect performance or reliability. To meet PMUs instrumental importance for timing V&V, we advocate for PMUs in automotive chips that explicitly track activities related to worst-case (rather than average) softwares behavior, are recognized as an ISO-26262 mandatory high-integrity hardware service, and are accompanied with detailed documentation that enables their effective use to derive reliable timing estimatesThis work has also been partially supported by the Spanish Ministry of Economy and Competitiveness (MINECO) under grant TIN2015-65316-P and the HiPEAC Network of Excellence. Jaume Abella has been partially supported by the MINECO under Ramon y Cajal postdoctoral fellowship number RYC-2013-14717. Enrico Mezzet has been partially supported by the Spanish Ministry of Economy and Competitiveness under Juan de la Cierva-Incorporación postdoctoral fellowship number IJCI-2016- 27396.Peer ReviewedPostprint (author's final draft

PARADISE: A Framework for Evaluating Spoken Dialogue Agents

This paper presents PARADISE (PARAdigm for DIalogue System Evaluation), a general framework for evaluating spoken dialogue agents. The framework decouples task requirements from an agent's dialogue behaviors, supports comparisons among dialogue strategies, enables the calculation of performance over subdialogues and whole dialogues, specifies the relative contribution of various factors to performance, and makes it possible to compare agents performing different tasks by normalizing for task complexity.Comment: 10 pages, uses aclap, psfig, lingmacros, time

Execution time distributions in embedded safety-critical systems using extreme value theory

Several techniques have been proposed to upper-bound the worst-case execution time behaviour of programs in the domain of critical real-time embedded systems. These computing systems have strong requirements regarding the guarantees that the longest execution time a program can take is bounded. Some of those techniques use extreme value theory (EVT) as their main prediction method. In this paper, EVT is used to estimate a high quantile for different types of execution time distributions observed for a set of representative programs for the analysis of automotive applications. A major challenge appears when the dataset seems to be heavy tailed, because this contradicts the previous assumption of embedded safety-critical systems. A methodology based on the coefficient of variation is introduced for a threshold selection algorithm to determine the point above which the distribution can be considered generalised Pareto distribution. This methodology also provides an estimation of the extreme value index and high quantile estimates. We have applied these methods to execution time observations collected from the execution of 16 representative automotive benchmarks to predict an upper-bound to the maximum execution time of this program. Several comparisons with alternative approaches are discussed.The research leading to these results has received funding from the European Community’s Seventh Framework Programme [FP7/2007-2013] under the PROXIMA Project (grant agreement 611085). This study was also partially supported by the Spanish Ministry of Science and Innovation under grants MTM2012-31118 (2013-2015) and TIN2015-65316-P. Jaume Abella is partially supported by the Ministry of Economy and Competitiveness under Ramon y Cajal postdoctoral fellowship number RYC-2013- 14717.Peer ReviewedPostprint (author's final draft

On the tailoring of CAST-32A certification guidance to real COTS multicore architectures

The use of Commercial Off-The-Shelf (COTS) multicores in real-time industry is on the rise due to multicores' potential performance increase and energy reduction. Yet, the unpredictable impact on timing of contention in shared hardware resources challenges certification. Furthermore, most safety certification standards target single-core architectures and do not provide explicit guidance for multicore processors. Recently, however, CAST-32A has been presented providing guidance for software planning, development and verification in multicores. In this paper, from a theoretical level, we provide a detailed review of CAST-32A objectives and the difficulty of reaching them under current COTS multicore design trends; at experimental level, we assess the difficulties of the application of CAST-32A to a real multicore processor, the NXP P4080.This work has been partially supported by the Spanish Ministry of Economy and Competitiveness (MINECO) under grant TIN2015-65316-P and the HiPEAC Network of Excellence. Jaume Abella has been partially supported by the MINECO under Ramon y Cajal grant RYC-2013-14717.Peer ReviewedPostprint (author's final draft

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Paleodiversity of the Superfamily Ursoidea (Carnivora, Mammalia) in the Spanish Neogene, related to environmental changes

In the present study we analyse the diversity of the Superfamily Ursoidea during the Neogene of the Iberian Peninsula to further compare it with that of the Neogene of Western Europe to find the different associations of this group. The results indicate that both the diversity and the taxonomy amongst these two regions show important variations, thus letting their interpretation in terms of climatic differentiation. We might relate variations in the abundance of the Ursoidea to the environmental fluctuations taking place during the Miocene and Pliocene. Therefore, they could enable us to reach the assessment of these biogeographical distributions in order to deduce the preferential niches of each different group of Ursoidea.En este trabajo se analiza la diversidad de la Superfamilia Ursoidea durante el Neógeno de la Península Ibérica, comparándola con la de Europa Occidental de la misma época, con el objetivo de localizar las diferentes asociaciones de los miembros de este grupo. Los resultados indican que tanto la diversidad como la taxonomía varían considerablemente entre las dos regiones estudiadas pudiendo interpretarse en tér­minos de diferenciación climática. Estas variaciones en la abundancia de Ursoidea se pueden relacionar con las fluctuaciones ambientales que tuvieron lugar durante el Mioceno y el Plioceno. Por tanto, nos ayudarán a evaluar las causas de estas distribuciones biogeográficas y a encontrar los nichos preferentes de cada uno de los diferentes grupos de Ursoidea

Musteloidea (Carnivora, Mammalia) del Mioceno Superior de Venta del Moro (Valencia, España)

The purpose of the present work is to describe the Musteloidea from the Late Miocene locality of Venta del Moro (Valencia, Spain). We have identified the following species: Martes ginsburgi nov. sp., Lutra affinis Gervais, 1859, Plesiogulo monspessulanus Viret, 1939 and Promephitis alexejewi Schlosser, 1924. Besides Plesiogulo monspessulanus which was already described in this locality and in Las Casiones (MN 13, Teruel Basin), we are approaching an unedited Musteloidea assemblage from the Miocene of the Iberian Peninsula. The m1 of Martes ginsburgi nov. sp. is similar in size and morphology to the Asian species of the genus, M. anderssoni and M. zdanskyi, but it differs in having a very wide M1 with a developed lingual platform. The presence of Lutra affinis is the third register of this species in the fossil record, since it was only previously known from the Pliocene of Montpellier (France) and the terminal Miocene of Maramena (Greece). Promephitis alexejewi is the first appearance of this species in Europe, which has been only registered until now in several localities of Mongolia and China. It differs from the rest of Promephitis species in the possession of a narrower m1, with a very sectorial trigonid.Se describen los Musteloidea procedentes del Mioceno terminal (MN13) de Venta del Moro (Valencia, España). Se han determinado los siguientes taxones: Martes ginsburgi nov. sp., Lutra affinis Gervais, 1859, Plesiogulo monspessulanus Viret, 1939 y Promephitis alexejewi Schlosser, 1924. Exceptuando a P. monspessulanus, que ya se ha citado también en la MN13 de Las Casiones (Teruel), se trata de una asociación inédita en el Mioceno de la Península Ibérica. Martes ginsburgi nov. sp. se asemeja en talla y morfología del m1 a las especies asiáticas del mismo género M. anderssoni y M. zdanskyi, pero se diferencia de ellas por la posesión del un M1 muy ancho, con una plataforma lingual muy desarrollada. La presencia de Lutra affinis supone la tercera cita de esta especie en el registro fósil, ya que sólo se conocía en el Plioceno de Montpellier (Francia) y en el Mioceno terminal de Maramena (Grecia). Promephitis alexejewi supone la primera cita para Europa de esta especie registrada hasta ahora sólo en dos yacimientos de Mongolia y China. Se diferencia del resto de especies afines por la posesión de un m1 más estrecho, con trigónido muy sectorial

Computing Safe Contention Bounds for Multicore Resources with Round-Robin and FIFO Arbitration

Numerous researchers have studied the contention that arises among tasks running in parallel on a multicore processor. Most of those studies seek to derive a tight and sound upper-bound for the worst-case delay with which a processor resource may serve an incoming request, when its access is arbitrated using time-predictable policies such as round-robin or FIFO. We call this value upper-bound delay ( ubd ). Deriving trustworthy ubd statically is possible when sufficient public information exists on the timing latency incurred on access to the resource of interest. Unfortunately however, that is rarely granted for commercial-of-the-shelf (COTS) processors. Therefore, the users resort to measurement observations on the target processor and thus compute a “measured” ubdm . However, using ubdm to compute worst-case execution time values for programs running on COTS multicore processors requires qualification on the soundness of the result. In this paper, we present a measurement-based methodology to derive a ubdm under round-robin (RoRo) and first-in-first-out (FIFO) arbitration, which accurately approximates ubd from above, without needing latency information from the hardware provider. Experimental results, obtained on multiple processor configurations, demonstrate the robustness of the proposed methodology.The research leading to this work has received funding from: the European Union’s Horizon 2020 research and innovation programme under grant agreement No 644080(SAFURE); the European Space Agency under Contract 789.2013 and NPI Contract 40001102880; and COST Action IC1202, Timing Analysis On Code-Level (TACLe). This work has also been partially supported by the Spanish Ministry of Science and Innovation under grant TIN2015-65316-P. Jaume Abella has been partially supported by the MINECO under Ramon y Cajal postdoctoral fellowship number RYC-2013-14717. The authors would like to thanks Paul Caheny for his help with the proofreading of this document.Peer ReviewedPostprint (author's final draft