Peranan Psikologi Olahraga dalam Pencapaian Prestasi Atlet Senam Artistik Kabupaten Sijunjung

The purpose of this study was to see the extent of the role of sports psychology in artistic gymnastics. This type of research is qualitative. Data were taken through observation and interviews using a Likert scale questionnaire given to athletes, and data analysis was carried out by descriptive analysis. The results showed that in the training of gymnastics in Sijunjung Regency, the psychological aspects of athletes which included emotion, intelligence, intelligence, tension, discipline, aggressiveness, self-confidence, motivation, were still in the less category, this was due to the lack of attention paid coach in fostering artistic gymnastics. Conclusion, the psychological aspect is very much needed in supporting the artistic gymnastics athlete's presentation Keywords: Psychology, Artistic Gymnastics, Athlete Achievemen

PENGEMBANGAN INSTRUMEN TES KETERAMPILAN FRONT HANDSPRING ATLET SENAM LANTAI

Permasalahan yang utama ketika penulis melakukan observasi dan wawancara dengan pelatih senam Semen Padang adalah jarang dilakukannya evaluasi baik terhadap kondisi fisik maupun teknik pada atlet senam lantai. Hal ini menyebabkan perkembangan hasil latihan tidak bisa terpantau dengan teratur. Salah satu keterampilan teknik senam lantai yang belum ada ukur yang baku adalah keterampilan fronthandspring. Untuk itulah menyikapi masalah ini maka penulis tertarik untuk membuat instrument tes keterampilan front handspring dari atlet senam lantai Klub PT. Semen Padang. Adapun tujuan dari penelitian ini adalah untuk membuat instrument tes keterampilan teknik front handspring pada atlet senam lantai untuk memberikan solusi dari permasalahan yang ada. Penelitian ini menggunakan metode penelitian pengembangan Borg dan Gall Luaran dari penelitian ini adalah model tes keterampilan front handsprings. Hasil penelitian menyebutkan: 1) Berdasarkan validasi para ahli dan hasil uji coba dihasilkan suatu produk model tes keterampilan front handspring untuk atlet senam lantai secara keseluruhan layak dipakai (2) Berdasarkan hasil uji coba kelompok kecil, dan uji coba lapangan dapat dinyatakan bahwa produk yang berupa tes keterampilan front handspring valid dan layak untuk digunakan

Kedudukan hak atas tanah dalam pengadaan tanah bagi pembangunan untuk kepentingan umum (analisis substansi undang undang no. 2 tahun 2012 tentang pengadaan tanah bagi pembangunan demi kepentingan umum

Hal 93-10

Основні рухові навички дітей на островах Ментавай: корінні племена Індонезії

Background and purpose. Various studies have investigated Fundamental Movement Skills (FMS) in children and factors that might improve them. However, studies examining FMS in children of indigenous tribes remain limited. Thus, this research aims to identify and analyze the relationship between sociocultural life, parenting, and level of education among indigenous tribe children who live on Mentawai Island. The research is also keen on comparing FMS between genders.  Materials and methods. This research employed qualitative and quantitative methods. It was grounded by phenomenology and FMS tests. A total of 15 parents, 3 teachers, and 70 young children (aged 5-7 years) participated voluntarily. The children’s genders comprised boys (n=38) and girls (n=32). Data in this research were collected from observation, semi-structured interviews, and FMS tests (locomotor, non-locomotor and manipulative). Then, they were analyzed using a thematic method and t-test to compare the level of FMS among the children.  Results. Based on the analysis, parents stated they involved their children in socio-cultural life. Also, children were educated to live independently and given freedom to play. However, the study did not find any relationship between parent’s educational level and FMS. This was evidenced by statistical analysis, in which the mean score of FMS among early childhood in Mentawai Island was 35.46 (good). Following that, boys had better FMS than girls (P<0,05), with a mean score of 37.08>33.53. Conclusions. Children need to be given the freedom to actively take part in physical activities in order to gain physical experiences and better FMS. This study recommends future research involving other factors and comparing FMS between children of indigenous tribes and those who live in urban areas. Історія питання. Різноманітні дослідження вивчали основні рухові навички (ОРН) і пов’язані з ними фактори для покращення ОРН у дітей молодшого віку. Проте кількість досліджень, які включають дітей молодшого віку у корінних племенах як предмет дослідження, залишається дуже обмеженою. Мета дослідження. Метою цього дослідження є вивчення та аналіз взаємозв’язку між соціокультурним життям, вихованням дітей і рівнем освіти батьків і впливом цих чинників на ОРН дітей молодшого віку у корінних племенах на островах Ментавай із наступним порівнянням ОРН хлопчиків і дівчат. Матеріали та методи. використовують якісні методи на основі феноменології та кількісні методи на основі тесту ОРН. Загалом у цьому дослідженні взяли участь 15 батьків, 3 вчителі дошкільної освіти та 70 дітей молодшого віку (віком 5–7 років), серед яких були хлопчики (n = 38) і дівчатка (n = 32). Якісні дані були отримані під час спостереження та напівструктурованих інтерв’ю, а потім проаналізовані за допомогою тематичного аналізу. Тоді як кількісні дані були отримані з тесту ОРН (локомоторних, нелокомоторних і маніпуляційних), а потім проаналізовані за допомогою описової статистики та t-критерію Стьюдента для їх порівняння. Результати. Отримані дані свідчать, що батьки стверджують, що вони завжди залучають своїх дітей до соціокультурного життя, дітей навчають самостійного життя та дають їм вільно гратися. Однак ми не виявили жодного впливу рівня освіти батьків на ОРН. Статистичний аналіз свідчить про те, що показник ОРН дітей молодшого віку у корінних племенах островів Ментавай становить 35,46 (гарна класифікація). При цьому хлопці показали кращу результативність, ніж дівчата (p <0,05), із середнім балом 37,08 >33,53 і різницею 3,55. Висновки. Дітям потрібно давати свободу активно залучатися до фізичної активності, щоб вони отримували гарний досвід руху та ОРН. Потрібні наступні дослідження, щоб включити інші фактори та порівняти ОРН у дітей молодшого віку між корінними племенами та міськими етнічними групами

Perlindungan hukum terhadap pemegang sertipikat pengganti karena hilang guna menciptakan kepastian hukum dikantor pertanahan kabupaten sukoharjo

Hal 109-11

Android-based gymnastics learning media to improve handstand skills in junior high school students

Handstand skills are one of the materials that must be mastered by students through Physical Education (PE) learning. However, the learning media used by the teacher has not been effective in achieving this goal. Therefore, this study aims to develop Android-based gymnastics learning media to improve handstand skills in junior high school students. The design used is Research and Development (R & D) which adopts the Plomp model and pre-experimental to test its effectiveness. A total of 47 junior high school students in Indonesia participated in this study. Then, 9 experts were also involved to assess the feasibility of the product before it was implemented. The procedures in this study consisted of preliminary research, prototyping phase, and assessment phase. Product effectiveness testing includes pre-test data, use of Android-based learning media, and post-test data. The instrument used was a handstand skills test, and the duration of the treatment was ± 1 month. Validity and reliability data were analysed using the validity coefficient V from Aiken and Intraclass Correlation Coefficients (ICC), while product effectiveness used a t-test. The results showed that the average validity was 0.87 (high) and the reliability was 0.88 (very high). The results of testing the effectiveness of the product also showed that the Android-based gymnastics learning media was effective for improving handstand skills (p pre-test of 63.45 and the difference is 7.48. In conclusion, students in junior high school can develop their handstand skills by using Android-based gymnastics learning media. This research is expected to be able to overcome the limitations in learning, both for PE teachers, junior high school students, and gymnastics practitioners in improving handstand skills

Design of Children’s Motor Training Tools Using Sensor-Based Agility Components in Physical Education Learning

Abstract— The This study aims to design a motor skill training tool for children using sensor-based agility components in pgysical education learning. This study uses a research and development design. the materials used are Arduino, Connector, LED, Sensor tool, Power button, and Tool cover.  After the product design is made, Collecting research data by conducting direct interviews with experts. it will then be validated by a competent expert. In this study, we asked for validation from three experts, namely: (1) evaluation and exercise evaluation (2) instrumentation physicist (3) motor skills expert. Collecting research data by conducting direct interviews with experts. Based on the expert validation test, the design of skill training tools using sensor-based agility components gets effective results, so that they can be used to carry out motor skills exercises. The importance of motor skills as the basis for every child's active life, with the help of tools to help children to encourage themselves to practice, Design of motor skills training tools with sensor-based agility components has the potential and effectiveness to train children's motor skills

Pengaruh pendekatan permainan mengajar dalam proses pembelajaran senam untuk meningkatkan roll forward

This study aims to analyze the effectiveness of the gymnastic learning model, which makes students more active during learning to improve students rolling skills. This type of research is an experiment with a pre and post-test design. 34 people with an average age of 15 years, consisting of 16 men and 18 women, participated in this study. Subjects were divided into two groups the experimental and control groups. They were taking research subjects using a purposive sampling technique. The control group carried out an independent study according to the instructions from the teacher, while the experimental group was treated with a play learning model according to the treatment program that had been made in each lesson. The forward roll skill test instrument uses a forward roll skill test sheet which contains a forward roll assessment indicator, which consists of 10 assessment indicators, starting from the initial phase, the primary phase, and the final phase for the forward roll movement. Data analysis was performed using the SPSS application with the Paired t-test method. This study's results reported a significant difference in the experimental group (p<0.05) compared to the control group. Each group has an average difference so that the learning model applied can improve forward-rolling skills in gymnastic materials.  Penelitian ini bertujuan untuk menganalisis efektivitas model pembelajaran senam, yang membuat siswa lebih aktif selama pembelajaran untuk meningkatkan kemampuan rolling siswa. Jenis penelitian ini merupakan percobaan dengan desain pre dan post-test. 34 orang dengan usia rata-rata 15 tahun, terdiri dari 16 pria dan 18 wanita, berpartisipasi dalam penelitian ini. Subjek dibagi menjadi dua kelompok, kelompok eksperimen dan kontrol. Mereka mengambil subjek penelitian dengan menggunakan teknik purposive sampling. Kelompok kontrol melakukan belajar mandiri sesuai petunjuk dari guru, sedangkan kelompok eksperimen diperlakukan dengan model pembelajaran bermain sesuai program perlakuan yang telah dibuat dalam setiap pembelajaran. Instrumen uji keterampilan roll maju menggunakan lembar tes keterampilan roll maju yang berisi indikator penilaian roll maju, yang terdiri dari 10 indikator penilaian, mulai dari fase awal, fase utama, dan fase akhir untuk gerakan roll maju. Analisis data dilakukan dengan menggunakan aplikasi SPSS dengan metode Paired t-test. Hasil penelitian ini melaporkan perbedaan yang signifikan pada kelompok eksperimen (p<0,05) dibandingkan dengan kelompok kontrol. Setiap kelompok memiliki perbedaan rata-rata sehingga model pembelajaran yang diterapkan dapat meningkatkan kemampuan maju guling dalam materi senam

Розробка інструментів тестування базових рухових навичок для дітей молодшого віку

Study purpose. The aim of the study was to develop a manual and easy test instrument for basic movement skills in early childhood. Materials and methods. In this work, we use a research and development (R&D) method. The research procedures are: (1) the first stage is a preliminary study in the form of potential problems, data collection, and needs analysis, (2) the second stage is instrument development planning, and (3) the third stage is trial, expert evaluations, and product revisions, and (4) the fourth stage is model implementation. A total of 155 children aged 4-6 years participated in this study. Statistical analysis used is the product-moment correlation for the validity test and Cronbach alpha for the reliability test. Data were analyzed using the SPSS application. Results. The results of this study are 1) the creation of a basic movement skill test instrument that can measure three components, namely locomotor, non-locomotor, and manipulative. 2) Based on this validity test, from 15 research instruments of basic movement skills (Y) tested, 15 items were obtained with r-count > 0.133 and were declared valid to be used in capturing research data. 3) The results obtained were r -count = 0.676 and r table 0.133, so the value of r arithmetic > r table, then this instrument is declared reliable and can be used as a data collection tool. Conclusions. The development of basic motion test instruments produce instruments that can measure and evaluate the basic movement skills of children aged 4-6 years which include three components, namely, locomotor, non-locomotor, and manipulative.Мета дослідження. Мета цього дослідження полягала в тому, щоб розробити ручний і зручний тестувальний інструмент для базових рухових навичок у дітей молодшого віку. Матеріали та методи. У цій роботі ми використовуємо метод дослідження та розробки (R&D). Дослідницькі процедури: (1) перший етап – це попереднє дослідження у формі потенційних проблем, збору даних та аналізу потреб, (2) другий етап – планування розробки інструмента, (3) третій етап – випробування, експертні оцінки та доопрацювання продукту, (4) четвертий етап – впровадження моделі. У цьому дослідженні брали участь загалом 155 дітей віком 4–6 років. Як статистичний аналіз використовували коефіцієнт кореляції Пірсона для тесту на валідність та альфу Кронбаха для тесту на надійність. Аналіз даних здійснювали з використанням програмного забезпечення SPSS. Результати. Результати цього дослідження полягають у 1) створенні інструмента тестування базових рухових навичок, який може вимірювати три компоненти, а саме локомоторний, нелокомоторний та маніпуляційний. 2) На підставі цього тесту на валідність із 15 протестованих дослідницьких інструментів для базових рухових навичок (Y) було отримано 15 елементів зі значенням r-count>0,133 та визнано їх дійсними для використання при зборі даних досліджень. 3) Одержані результати були r-count = 0,676 та r table 0,133, тому значення r arithmetic > r table, тоді цей інструмент оголошено надійним і його можна використовувати як засіб збору даних. Висновки. Розробка інструментів для тестування базових рухів створює інструменти, які можуть вимірювати та оцінювати базові рухові навички дітей віком 4–6 років, які включають три компоненти, а саме: локомоторний, нелокомоторний та маніпуляційний

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR) technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward) and 5’- CAAGATAACCATGTACGGTGC-3’ (backward). A single band of 300 bp which was specific for canine distemper virus CDV) was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.</div