297 research outputs found

    Understanding the Evolutionary Relationships and Major Traits of \u3cem\u3eBacillus\u3c/em\u3e through Comparative Genomics

    Get PDF
    Background: The presence of Bacillus in very diverse environments reflects the versatile metabolic capabilities of a widely distributed genus. Traditional phylogenetic analysis based on limited gene sampling is not adequate for resolving the genus evolutionary relationships. By distinguishing between core and pan-genome, we determined the evolutionary and functional relationships of known Bacillus. Results: Our analysis is based upon twenty complete and draft Bacillus genomes, including a newly sequenced Bacillus isolate from an aquatic environment that we report for the first time here. Using a core genome, we were able to determine the phylogeny of known Bacilli, including aquatic strains whose position in the phylogenetic tree could not be unambiguously determined in the past. Using the pan-genome from the sequenced Bacillus, we identified functional differences, such as carbohydrate utilization and genes involved in signal transduction, which distinguished the taxonomic groups. We also assessed the genetic architecture of the defining traits of Bacillus, such as sporulation and competence, and showed that less than one third of the B. subtilis genes are conserved across other Bacilli. Most variation was shown to occur in genes that are needed to respond to environmental cues, suggesting that Bacilli have genetically specialized to allow for the occupation of diverse habitats and niches. Conclusions: The aquatic Bacilli are defined here for the first time as a group through the phylogenetic analysis of 814 genes that comprise the core genome. Our data distinguished between genomic components, especially core vs. pan-genome to provide insight into phylogeny and function that would otherwise be difficult to achieve. A phylogeny may mask the diversity of functions, which we tried to uncover in our approach. The diversity of sporulation and competence genes across the Bacilli was unexpected based on previous studies of the B. subtilis model alone. The challenge of uncovering the novelties and variations among genes of the non-subtilis groups still remains. This task will be best accomplished by directing efforts toward understanding phylogenetic groups with similar ecological niches

    Editorial : Plant transformation

    Get PDF
    Plant transformation provides a key tool for much basic research, such as the study of gene functions and interactions, protein–protein interactions, developmental processes, as well as applications for crop improvement and the development of plant bioreactors to produce vaccines. Efficient and reproducible transformation technologies are not only essential for the development of transgenic plants but also critical for other applications like transient gene expression studies and gene editing.Instituto de BiotecnologíaFil: Hopp, Horacio Esteban. Instituto Nacional de Tecnología Agropecuaria (INTA). Instituto de Agrobiotecnología y Biología Molecular; ArgentinaFil: Hopp, Horacio Esteban. Consejo Nacional de Investigaciones Científicas y Técnicas; ArgentinaFil: Hopp, Horacio Esteban. Universidad de Buenos Aires. Facultad de Ciencias Exactas y Naturales. Departamento de Fisiología, Biología Molecular y Celular; ArgentinaFil: Spangenberg, German. La Trobe University. Agriculture Victoria. AgriBio; AustraliaFil: Herrera-Estrella, Luis. Texas Tech University. Institute of Genomics for Crop Abiotic Stress Tolerance. Plant and Soil Science Department; Estados UnidosFil: Herrera-Estrella, Luis. Centro de Investigación y de Estudios Avanzados. Unidad de Genómica Avanzada. Laboratorio Nacional de Genómica para la Biodiversidad (LANGEBIO); Méxic

    Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome

    Get PDF
    We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid

    Deep sampling of the Palomero maize transcriptome by a high throughput strategy of pyrosequencing

    Get PDF
    <p>Abstract</p> <p>Background</p> <p>In-depth sequencing analysis has not been able to determine the overall complexity of transcriptional activity of a plant organ or tissue sample. In some cases, deep parallel sequencing of Expressed Sequence Tags (ESTs), although not yet optimized for the sequencing of cDNAs, has represented an efficient procedure for validating gene prediction and estimating overall gene coverage. This approach could be very valuable for complex plant genomes. In addition, little emphasis has been given to efforts aiming at an estimation of the overall transcriptional universe found in a multicellular organism at a specific developmental stage.</p> <p>Results</p> <p>To explore, in depth, the transcriptional diversity in an ancient maize landrace, we developed a protocol to optimize the sequencing of cDNAs and performed 4 consecutive GS20–454 pyrosequencing runs of a cDNA library obtained from 2 week-old <it>Palomero Toluqueño </it>maize plants. The protocol reported here allowed obtaining over 90% of informative sequences. These GS20–454 runs generated over 1.5 Million reads, representing the largest amount of sequences reported from a single plant cDNA library. A collection of 367,391 quality-filtered reads (30.09 Mb) from a single run was sufficient to identify transcripts corresponding to 34% of public maize ESTs databases; total sequences generated after 4 filtered runs increased this coverage to 50%. Comparisons of all 1.5 Million reads to the Maize Assembled Genomic Islands (MAGIs) provided evidence for the transcriptional activity of 11% of MAGIs. We estimate that 5.67% (86,069 sequences) do not align with public ESTs or annotated genes, potentially representing new maize transcripts. Following the assembly of 74.4% of the reads in 65,493 contigs, real-time PCR of selected genes confirmed a predicted correlation between the abundance of GS20–454 sequences and corresponding levels of gene expression.</p> <p>Conclusion</p> <p>A protocol was developed that significantly increases the number, length and quality of cDNA reads using massive 454 parallel sequencing. We show that recurrent 454 pyrosequencing of a single cDNA sample is necessary to attain a thorough representation of the transcriptional universe present in maize, that can also be used to estimate transcript abundance of specific genes. This data suggests that the molecular and functional diversity contained in the vast native landraces remains to be explored, and that large-scale transcriptional sequencing of a presumed ancestor of the modern maize varieties represents a valuable approach to characterize the functional diversity of maize for future agricultural and evolutionary studies.</p

    Cancer Reduces Transcriptome Specialization

    Get PDF
    A central goal of cancer biology is to understand how cells from this family of genetic diseases undergo specific morphological and physiological changes and regress to a de-regulated state of the cell cycle. The fact that tumors are unable to perform most of the specific functions of the original tissue led us to hypothesize that the degree of specialization of the transcriptome of cancerous tissues must be less than their normal counterparts. With the aid of information theory tools, we analyzed four datasets derived from transcriptomes of normal and tumor tissues to quantitatively test the hypothesis that cancer reduces transcriptome specialization. Here, we show that the transcriptional specialization of a tumor is significantly less than the corresponding normal tissue and comparable with the specialization of dedifferentiated embryonic stem cells. Furthermore, we demonstrate that the drop in specialization in cancerous tissues is largely due to a decrease in expression of genes that are highly specific to the normal organ. This approach gives us a better understanding of carcinogenesis and offers new tools for the identification of genes that are highly influential in cancer progression

    Transcriptomics and molecular evolutionary rate analysis of the bladderwort (Utricularia), a carnivorous plant with a minimal genome

    Get PDF
    <p>Abstract</p> <p>Background</p> <p>The carnivorous plant <it>Utricularia gibba </it>(bladderwort) is remarkable in having a minute genome, which at ca. 80 megabases is approximately half that of <it>Arabidopsis</it>. Bladderworts show an incredible diversity of forms surrounding a defined theme: tiny, bladder-like suction traps on terrestrial, epiphytic, or aquatic plants with a diversity of unusual vegetative forms. <it>Utricularia </it>plants, which are rootless, are also anomalous in physiological features (respiration and carbon distribution), and highly enhanced molecular evolutionary rates in chloroplast, mitochondrial and nuclear ribosomal sequences. Despite great interest in the genus, no genomic resources exist for <it>Utricularia</it>, and the substitution rate increase has received limited study.</p> <p>Results</p> <p>Here we describe the sequencing and analysis of the <it>Utricularia gibba </it>transcriptome. Three different organs were surveyed, the traps, the vegetative shoot bodies, and the inflorescence stems. We also examined the bladderwort transcriptome under diverse stress conditions. We detail aspects of functional classification, tissue similarity, nitrogen and phosphorus metabolism, respiration, DNA repair, and detoxification of reactive oxygen species (ROS). Long contigs of plastid and mitochondrial genomes, as well as sequences for 100 individual nuclear genes, were compared with those of other plants to better establish information on molecular evolutionary rates.</p> <p>Conclusion</p> <p>The <it>Utricularia </it>transcriptome provides a detailed genomic window into processes occurring in a carnivorous plant. It contains a deep representation of the complex metabolic pathways that characterize a putative minimal plant genome, permitting its use as a source of genomic information to explore the structural, functional, and evolutionary diversity of the genus. Vegetative shoots and traps are the most similar organs by functional classification of their transcriptome, the traps expressing hydrolytic enzymes for prey digestion that were previously thought to be encoded by bacteria. Supporting physiological data, global gene expression analysis shows that traps significantly over-express genes involved in respiration and that phosphate uptake might occur mainly in traps, whereas nitrogen uptake could in part take place in vegetative parts. Expression of DNA repair and ROS detoxification enzymes may be indicative of a response to increased respiration. Finally, evidence from the bladderwort transcriptome, direct measurement of ROS <it>in situ</it>, and cross-species comparisons of organellar genomes and multiple nuclear genes supports the hypothesis that increased nucleotide substitution rates throughout the plant may be due to the mutagenic action of amplified ROS production.</p

    Identification and characterization of the PhhR regulon in Pseudomonas putida

    Get PDF
    Pseudomonas putida is a soil microorganism that utilizes aromatic amino acids present in root exudates as a nitrogen source. We have previously shown that the PhhR transcriptional regulator induces phhAB genes encoding a phenylalanine hydroxylase. In this study we show, using microarray assays and promoter fusions, that PhhR is a global regulator responsible for the activation of genes essential for phenylalanine degradation, phenylalanine homeostasis and other genes of unknown function. Recently, it has been shown that phenylalanine catabolism occurs through more than one pathway. One of these possible pathways involves the metabolism of phenylalanine via tyrosine, p-hydroxyphenylpyruvate, and homogentisate. We identified two genes within this pathway that encode an acyl-CoA transferase involved in the metabolism of acetoacetate. All genes in this pathway were induced in response to phenylalanine in a PhhR-proficient background. The second potential degradative pathway involves the degradation of phenylalanine to produce phenylpyruvate, which seems to be degraded via phenylacetyl-CoA. A number of mutants in the paa genes encoding phenylacetyl-CoA degradation enzymes fail to grow on phenylpyruvate or phenylacetate, further supporting the existence of this second pathway. We found that the PhhR regulon also includes genes involved in the biosynthesis of aromatic amino acids that are repressed in the presence of phenylalanine, suggesting the possibility of feedback at the transcriptional level. In addition, we found that PhhR modulates the level of expression of the broad-substrate-specificity MexEF/OprN efflux pump. Expression from this pump is under the control of mexT gene product because phenylalanine-dependent transcription from the mexE promoter does not occur in a mexT mutant background. These results place PhhR as an important regulator in the control of bacterial responses to aromatic amino acids

    A Phosphite Dehydrogenase Variant with Promiscuous Access to Nicotinamide Cofactor Pools Sustains Fast Phosphite-Dependent Growth of Transplastomic Chlamydomonas reinhardtii

    Get PDF
    Heterologous expression of the NAD(+)-dependent phosphite dehydrogenase (PTXD) bacterial enzyme from Pseudomonas stutzerii enables selective growth of transgenic organisms by using phosphite as sole phosphorous source. Combining phosphite fertilization with nuclear expression of the ptxD transgene was shown to be an alternative to herbicides in controlling weeds and contamination of algal cultures. Chloroplast expression of ptxD in Chlamydomonas reinhardtii was proposed as an environmentally friendly alternative to antibiotic resistance genes for plastid transformation. However, PTXD activity in the chloroplast is low, possibly due to the low NAD(+)/NADP(+) ratio, limiting the efficiency of phosphite assimilation. We addressed the intrinsic constraints of the PTXD activity in the chloroplast and improved its catalytic efficiency in vivo via rational mutagenesis of key residues involved in cofactor binding. Transplastomic lines carrying a mutagenized PTXD version promiscuously used NADP(+) and NAD(+) for converting phosphite into phosphate and grew faster compared to those expressing the wild type protein. The modified PTXD enzyme also enabled faster and reproducible selection of transplastomic colonies by directly plating on phosphite-containing medium. These results allow using phosphite as selective agent for chloroplast transformation and for controlling biological contaminants when expressing heterologous proteins in algal chloroplasts, without compromising on culture performance
    corecore