Recognition and discrimination of target mRNAs by Sib RNAs, a cis-encoded sRNA family

Five Sib antitoxin RNAs, members of a family of cis-encoded small regulatory RNAs (sRNAs) in Escherichia coli, repress their target mRNAs, which encode Ibs toxins. This target repression occurs only between cognate sRNA–mRNA pairs with an exception of ibsA. We performed co-transformation assays to assess the ability of SibC derivatives to repress ibsC expression, thereby revealing the regions of SibC that are essential for ibsC mRNA recognition. SibC has two target recognition domains, TRD1 and TRD2, which function independently. The target site for TRD1 is located within the ORF of ibsC, whereas the target site for TRD2 is located in the translational initiation region. The TRD1 sequence is sufficient to repress ibsC expression. In contrast, TRD2 requires a specific structure in addition to the recognition sequence. An in vitro structural probing analysis showed that the initial interactions at these two recognition sites allowed base-pairing to progress into the flanking sequences. Displacement of the TRD1 and TRD2 domains of SibC by the corresponding domains of SibD changed the target specificity of SibC from ibsC to ibsD, suggesting that these two elements modulate the cognate target recognition of each Sib RNA by discriminating among non-cognate ibs mRNAs

The filamentous growth of MG1655/pCnuK9E can be reversed to normal growth.

<p>MG1655/pCnuK9E cells grown in LB liquid medium at 37°C became filamentous 4 h after induction of CnuK9E (B, 4 h). When the culture was transferred to 25°C and continued, cells resumed normal growth 4 h after the temperature shift (B, 8 h). The cell growth of this experiment is presented as OD₆₀₀ vs. growth time (A).</p

Relative concentration of <i>dic</i> transcripts^*.

*<p>These values were measured by three independent experiments. Average values are presented.</p

Filamentous growth of MG1655/pCnuK9E.

<p>MG1655 harboring pCnuK9E was grown in LB liquid medium at 37°C. Cells were stained with Hoechst 33342 dye. Cells grew normally when CnuK9E was not induced (A). When the same microscopic field was observed under UV light, each cell had one or two discrete nuclei (B). When CnuK9E was induced, however, the cells adopted a filamentous form (C). MG1655 cells harboring pCnu grew normally when Cnu was overexpressed to the same level of CnuK9E (data not shown). The same cells in C had several discrete nuclear regions when observed under UV light (D).</p

Plasmids used in this study.

<p>Plasmids are schematically presented along with their names, size in base pairs (bp), and purpose. Genes are depicted as arrows pointing in the direction of transcription. The origin of DNA replication (<i>ori</i>) is presented in a box with the conventional name of the plasmid. pOri14, pHL1105, and pHL1105* have the same sequence except the operator. The following sequences are present at the operator; 5′ATGATCGGTGATCCTG for pOri14, 5′TTGTTAGTCATAACTAACAA for pHL1105, and 5′TTGTTAGTCATAACTCACAA for pHL1105*. pOri14 has 7219 bp, and both pHL1105 and pHL1105* have 7216 bp each.</p

Amino acid alignments of DicA with functionally and structurally homologous proteins.

<p>The N-terminal part of DicA lines up well with the N-terminus of the C2 (GenBank: NP_059606.1) protein from the <i>Salmonella</i> phage P22. The C-terminal part of DicA shares significant amino acid sequence homology with the N-termini of RovA (GenBank: AAK01704.1) of <i>Yersinia</i> and SlyA (GenBank: AAL55673.1) of <i>Salmonella</i>. Identical amino acids with DicA are marked in black. The winged helix DNA-binding domain is underlined with the secondary structure labeled. The amino acid sequences are taken from the GenBank database, and the sequence comparison algorithm BLAST <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0045236#pone.0045236-Altschul1" target="_blank">[33]</a> was used.</p

Growth Ratio.

a<p>The ratio of the growth rates between the two media (LB-Str/LB) measures the degree of DicA binding to Oc, higher the better.</p

Relative location of <i>dic</i> genes on the <i>E. coli</i> chromosome and DNA sequence of the promoter region of the <i>dicA</i> and <i>dicC</i> genes (<i>PdicAC</i>).

<p>(A) A portion of the Qin prophage in the <i>E. coli</i> genome between 35.47 and 35. 52 min is shown with genes involved in cell division inhibition <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0045236#pone.0045236-Bejar3" target="_blank">[27]</a>. Arrows indicate the direction of transcription and relative size of the genes. The <i>dicF</i> gene produces RNA only <a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0045236#pone.0045236-Tetart1" target="_blank">[30]</a>. (B) DNA sequence of the promoter region of the <i>dicA</i> and <i>dicC</i> genes is shown. The putative DicA-binding site (Oc) is boxed. The nucleotide changes detected in a few cloned <i>PdicAC</i> DNA fragment are shown above the arrows with numbers in parentheses that indicate the number of incidents. A putative −10 and −35 promoter sequence of the <i>dicC</i> gene is underlined. The transcription initiation site of the <i>dicC</i> gene is indicated as +1 for <i>dicC</i> (<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0045236#pone.0045236.s003" target="_blank">Fig. S3</a>). The promoter sequence for the <i>dicA</i> gene is not obvious with DNA sequence information only.</p