Immunity of intersubband polaritons to inhomogeneous broadening

We demonstrate that intersubband (ISB) polaritons are robust to inhomogeneous effects originating from the presence of multiple quantum wells (MQWs). In a series of samples that exhibit mid-infrared ISB absorption transitions with broadenings varying by a factor of 5 (from 4 meV to 20meV), we have observed polariton linewidths always lying in the 4 - 7 meV range only. We have experimentally verified the dominantly inhomogeneous origin of the broadening of the ISB transition, and that the linewidth reduction effect of the polariton modes persists up to room-temperature. This immunity to inhomogeneous broadening is a direct consequence of the coupling of the large number of ISB oscillators to a single photonic mode. It is a precious tool to gauge the natural linewidth of the ISB plasmon , that is otherwise masked in such MQWs system , and is also beneficial in view of perspective applications such as intersubband polariton lasers

The Protein Kinase KIS Impacts Gene Expression during Development and Fear Conditioning in Adult Mice

The brain-enriched protein kinase KIS (product of the gene UHMK1) has been shown to phosphorylate the human splicing factor SF1 in vitro. This phosphorylation in turn favors the formation of a $U2AF^{65}$-SF1-RNA complex which occurs at the 3′ end of introns at an early stage of spliceosome assembly. Here, we analyzed the effects of KIS knockout on mouse SF1 phosphorylation, physiology, adult behavior, and gene expression in the neonate brain. We found SF1 isoforms are differently expressed in KIS-ko mouse brains and fibroblasts. Re-expression of KIS in fibroblasts restores a wild type distribution of SF1 isoforms, confirming the link between KIS and SF1. Microarray analysis of transcripts in the neonate brain revealed a subtle down-regulation of brain specific genes including cys-loop ligand-gated ion channels and metabolic enzymes. Q-PCR analyses confirmed these defects and point to an increase of pre-mRNA over mRNA ratios, likely due to changes in splicing efficiency. While performing similarly in prepulse inhibition and most other behavioral tests, KIS-ko mice differ in spontaneous activity and contextual fear conditioning. This difference suggests that disregulation of gene expression due to KIS inactivation affects specific brain functions

Photon correlations for colloidal nanocrystals and their clusters

Images of semiconductor `dot in rods' and their small clusters are studied by measuring the second-order correlation function with a spatially resolving ICCD camera. This measurement allows one to distinguish between a single dot and a cluster and, to a certain extent, to estimate the number of dots in a cluster. A more advanced measurement is proposed, based on higher-order correlations, enabling more accurate determination of the number of dots in a small cluster. Nonclassical features of the light emitted by such a cluster are analyzed.Comment: 4 pages, 4 figure

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Photon correlations for colloidal nanocrystals and their clusters

Images of semiconductor “dot-in-rods” and their small clusters are studied by measuring the second-order correlation function with a spatially resolving intensified CCD camera. This measurement allows one to distinguish between a single dot and a cluster and, to a certain extent, to estimate the number of dots in a cluster. A more advanced measurement is proposed, based on higher-order correlations, enabling more accurate determination of the number of dots in a small cluster. Nonclassical features of the light emitted by such a cluster are analyzed

Room temperature strong light-matter coupling in three dimensional terahertz meta-atoms

We demonstrate strong light-matter coupling in three dimensional terahertz meta-atoms at room temperature. The intersubband transition of semiconductor quantum wells with a parabolic energy potential is strongly coupled to the confined circuital mode of three-dimensional split-ring metal-semiconductor-metal resonators that have an extreme sub-wavelength volume (λ/10). The frequency of these lumped-element resonators is controlled by the size and shape of the external antenna, while the interaction volume remains constant. This allows the resonance frequency to be swept across the intersubband transition and the anti-crossing characteristic of the strong light-matter coupling regime to be observed. The Rabi splitting, which is twice the Rabi frequency (2ΩRabi), amounts to 20% of the bare transition at room temperature, and it increases to 28% at low-temperatur

Coupled-cavity terahertz quantum cascade lasers for single mode operation

We demonstrate the operation of coupled-cavity terahertz frequency quantum-cascade lasers composed of two sub-cavities separated by an air gap realized by optical lithography and dry etching. This geometry allows stable, single mode operation with typical side mode suppression ratios in the 30-40 dB range. We employ a transfer matrix method to model the mode selection mechanism. The obtained results are in good agreement with the measurements and allow prediction of the operating frequency

30-Day Postoperative Morbidity of Emergency Surgery for Obstructive Right- and Left-Sided Colon Cancer in Obese Patients: A Multicenter Cohort Study of the French Surgical Association

BACKGROUND: Emergency surgery impairs postoperative outcomes in colorectal cancer patients. No study has assessed the relationship between obesity and postoperative results in this setting. OBJECTIVE: To compare the results of emergency surgery for obstructive colon cancer (OCC) in an obese patient population with those in overweight and normal weight patient groups. METHODS: From 2000 to 2015, patients undergoing emergency surgery for OCC in French surgical centers members of the French National Surgical Association were included. Three groups were defined: normal weight (body mass index [BMI] < 25.0 kg/m2), overweight (BMI 25.0-29.9 kg/m2), and obese (BMI ≥30.0 kg/m2). RESULTS: Of 1,241 patients, 329 (26.5%) were overweight and 143 (11.5%) were obese. Obese patients had significantly higher American society of anesthesiologists score, more cardiovascular comorbidity and more hemodynamic instability at presentation. Overall postoperative mortality and morbidity were 8 and 51%, respectively, with no difference between the 3 groups. For obese patients with left-sided OCC, stoma-related complications were significantly increased (8 vs. 5 vs. 15%, p = 0.02). CONCLUSION: Compared with lower BMI patients, obese patients with OCC had a more severe presentation at admission but similar surgical management. Obesity did not increase 30-day postoperative morbidity except stoma-related complications for those with left-sided OCC