17 research outputs found
Morphological characterization of vaginal epithelial cells of santa inês ewes subjected to estrus synchronization
Vaginal cytology analysis has been used to evaluate the different stages of estrous cycle of several species; it presents a direct correlation with the animal’s hormonal state and provides essential information about the female reproductive tract conditions. Two staining methods were tested to evaluate the vaginal epithelial cell morphology of nulliparous and multiparous ewes during the estrus period. An intravaginal device impregnated with medroxyprogesterone acetate was kept into 10 nulliparous and 10 multiparous ewes for 14 days for estrus synchronization. Then, the progesterone device was withdrawn, and 300 IU of eCG was administered intramuscularly. Vaginal smears were prepared for posterior staining with Panotico or Giemsa stains when estrus was detected. The cells were classified into nucleated superficial, anucleate superficial, intermediate, parabasal, and basal. The Panotico and Giemsa staining of the different cell types studied were satisfactory. A predominance of intermediate epithelial cells (p<0.05) was found after staining. No difference in percentages of the different types of vaginal epithelial cells between nulliparous and multiparous ewes were found. Therefore, both staining methods were efficient, and a predominance of intermediate cells is found in nulliparous and multiparous ewes during the estrus period.Vaginal cytology analysis has been used to evaluate the different stages of estrous cycle of several species; it presents a direct correlation with the animal’s hormonal state and provides essential information about the female reproductive tract conditions. Two staining methods were tested to evaluate the vaginal epithelial cell morphology of nulliparous and multiparous ewes during the estrus period. An intravaginal device impregnated with medroxyprogesterone acetate was kept into 10 nulliparous and 10 multiparous ewes for 14 days for estrus synchronization. Then, the progesterone device was withdrawn, and 300 IU of eCG was administered intramuscularly. Vaginal smears were prepared for posterior staining with Panotico or Giemsa stains when estrus was detected. The cells were classified into nucleated superficial, anucleate superficial, intermediate, parabasal, and basal. The Panotico and Giemsa staining of the different cell types studied were satisfactory. A predominance of intermediate epithelial cells (p<0.05) was found after staining. No difference in percentages of the different types of vaginal epithelial cells between nulliparous and multiparous ewes were found. Therefore, both staining methods were efficient, and a predominance of intermediate cells is found in nulliparous and multiparous ewes during the estrus period
ANÁLISE ECONÔMICA SOBRE O MANEJO NUTRICIONAL E SANITÁRIO EM CRIAÇÕES DE OVINOS NAS PROPRIEDADES DO SUL DE TOCANTINS
With the objective of analyzing the impact of the nutritional and sanitary manages bioeconomically in properties of the South of the State of Tocantins, through productivity indices, it accomplished a survey, through questionnaire, in 12 properties, of the which, it was selected intentionally six, that it were divided in two groups: group "A", containing three properties that accomplish appropriate nutritional and sanitarium manages; and group "B", also with three properties whose nutritional and sanitarium manages are deficient. After completion of the questionnaire, for gauging of the productivity indices of each group, it can be glimpsed the magnitude of the impact of the nutritional and sanitary manages on the systems of creation of animals sheep, demonstrating that the properties of the group "A", in spite of the expenses with feeding and medicines, it possess more competitive and lucrative profile in relation to the group "B". Of ownership of the data of the indexes productivity, it took place an evolution of a flock, containing 100 ewes and three reproductive, where the group "A" presented a larger number of animals to be sloughtered, proving the profitability of the systems that use an appropriate nutritional and sanitarium manages rationally
Detecção de Leptospira pomona em sêmen bovino por eletroforese capilar fluorescente
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Leptospira pomona diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with Leptospira pomona (10 0 to 10 7 bacteria/ ml) and DNA was extracted by phenol/chloroform protocol. DNA fragments visualization was done by three electrophoresis methods: under UV light in 2 % agarose gel, silver staining 8% polyacrylamide gel and fluorescent capillary electrophoresis. The detection limit of capillary electrophoresis for Leptospira pomona was 10 2bacteria/ml. Under UV light, in 2 % agarose gel, the detection limit was of 10 4 bacteria/ ml while for silver stained 8 % polyacrylamide gel it was 10 2 bacteria/ ml. PCR with fluorescent capillary electrophoresis is an efficient and rapid diagnostic test for DNA detection of Leptospira in bovine semen and this can be an important tool for herd and semen sanitary control in artificial insemination centers
PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.Este estudo avaliou o limiar de detecção da técnica de PCR aliada à eletroforese capilar para diagnóstico da Brucella abortus em sêmen bovino. Doses inseminantes livres de patógenos foram contaminadas experimentalmente com B. abortus em escalas que variavam de 10(0) a 10(7) bactérias/mL e submetidas à extração de DNA pelo método de fenol/clorofórmio. A amplificação por PCR foi realizada utilizando-se oligonucleotídeos iniciadores, previamente descritos na literatura, BF-5'gcgctcaggctgccgacgcaa3' (cromóforo FAM) e BR-5'accagccattgcggtcggta3' para B. abortus.) Os pares de oligonucleotídeos geraram fragmentos de 193 pb. Após PCR, a visualização dos fragmentos foi realizada em gel de acrilamida 8% corada pela prata e por eletroforese capilar fluorescente em equipamento automático de análise de fragmentos de DNA. A detecção de DNA de B. abortus em sêmen bovino através de eletroforese capilar fluorescente foi possível a partir de concentração de 10³ bactérias/mL, enquanto que em gel de poliacrilamida 8% o limite de detecção foi de 10(5) bactérias/mL. A eletroforese capilar demonstrou ser uma alternativa rápida, eficaz e de alta sensibilidade na detecção de DNA de Brucella em sêmen bovino, podendo ser uma valiosa ferramenta para a avaliação da sanidade do rebanho e para o controle de qualidade do sêmen produzido em centrais de inseminação artificial
Nonlinear models for fitting growth curves of Nellore cows reared in the Amazon Biome
Growth curves of Nellore cows were estimated by comparing six nonlinear models: Brody, Logistic, two alternatives by Gompertz, Richards and Von Bertalanffy. The models were fitted to weight-age data, from birth to 750 days of age of 29,221 cows, born between 1976 and 2006 in the Brazilian states of Acre, Amapá, Amazonas, Pará, Rondônia, Roraima and Tocantins. The models were fitted by the Gauss-Newton method. The goodness of fit of the models was evaluated by using mean square error, adjusted coefficient of determination, prediction error and mean absolute error. Biological interpretation of parameters was accomplished by plotting estimated weights versus the observed weight means, instantaneous growth rate, absolute maturity rate, relative instantaneous growth rate, inflection point and magnitude of the parameters A (asymptotic weight) and K (maturing rate). The Brody and Von Bertalanffy models fitted the weight-age data but the other models did not. The average weight (A) and growth rate (K) were: 384.6±1.63 kg and 0.0022±0.00002 (Brody) and 313.40±0.70 kg and 0.0045±0.00002 (Von Bertalanffy). The Brody model provides better goodness of fit than the Von Bertalanffy model
High frequency of visceral leishmaniasis in dogs under veterinary clinical care in an intense transmission area in the state of Tocantins, Brazil
ABSTRACT: A direct search for parasites were used as the diagnostic test to determine the frequency of Leishmania spp. infection in dogs ( Canis lupus familiaris ) under veterinary clinical care in the city of Araguaína, Tocantins, Brazil. For this approach, lymph node cell samples were collected using needle aspiration from 649 dogs of different breeds and ages. Two hundred and sixty four (40.7%) dogs tested positive for amastigote forms of Leishmania spp. Furthermore, 202 (76.5%) dogs that tested positive showed some clinical sign of disease, while 62 (28.4%) dogs were asymptomatic. Dogs <2 years old or those that lived alongside poultry species in peri-domicile areas had a greater chance of infection (P<0.05). Our results revealed the importance of frequently monitoring leishmaniasis in dogs, and the need to train veterinary professionals who work in high-transmission areas on the clinical diagnosis of canine visceral leishmaniasis
Susceptibilidade antimicrobiana de sorovares de Salmonella sp. isolados de vísceras comestíveis e carcaças de aves abatidas no estado do Tocantins, Brasil
Submitted by Franciele Moreira ([email protected]) on 2018-01-25T17:25:30Z
No. of bitstreams: 2
Artigo - Silvia Minharro - 2015.pdf: 799714 bytes, checksum: 208c6a136928925cbcffd7a6c0095c76 (MD5)
license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5)Approved for entry into archive by Luciana Ferreira ([email protected]) on 2018-01-29T11:35:59Z (GMT) No. of bitstreams: 2
Artigo - Silvia Minharro - 2015.pdf: 799714 bytes, checksum: 208c6a136928925cbcffd7a6c0095c76 (MD5)
license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5)Made available in DSpace on 2018-01-29T11:35:59Z (GMT). No. of bitstreams: 2
Artigo - Silvia Minharro - 2015.pdf: 799714 bytes, checksum: 208c6a136928925cbcffd7a6c0095c76 (MD5)
license_rdf: 0 bytes, checksum: d41d8cd98f00b204e9800998ecf8427e (MD5)
Previous issue date: 2015-08Com o objetivo de observar os parâmetros estabelecidos pela Instrução Normativa 70 de 2003 do Ministério
da Agricultura Pecuária e Abastecimento, juntamente com o Programa Nacional de Monitoramento da
Prevalência e da Resistência Bacteriana em Frango, o qual prevê o monitoramento de Salmonella sp.
em produtos de frangos resfriados, foram estudadas carcaças e miúdos comestíveis (fígados e coração),
condenados ou não por pericardite/perihepatite, em 60 lotes de aves abatidos sob Sistema de Inspeção
Federal no estado do Tocantins, entre agosto de 2010 a junho de 2011. Foram isoladas 26 amostras
indicativas de Salmonella sp. em 11 lotes (18,33%), sendo mais de uma estirpe por tipo de amostra.
Os sorovares de maior frequência foram o Enteriditis (38,46%; 10/26) e Mbandaka (19,23%; 5/26),
ambos isolados de coração, fígado e carcaça. Quanto ao perfil de resistência aos antimicrobianos, foram
testados 12 princípios farmacológicos e as amostras apresentaram-se diferenciadas em alguns aspectos
do encontrado na literatura consultada, sendo a maioria sensível às tetraciclinas, porém apresentaram
100% de resistência a um ou mais principio ativo, principalmente para Sulfamethoxazole (30 mcg)
e Amoxicilina/Ácido Clavulânico (30 mcg). Apesar da Salmonella sp. ter sido isolada em carcaças
normais, os resultados encontram-se dentro do permitido pela legislação brasileira vigente para produtos
que ainda não sofreram processo de congelação. No entanto, deve-se sempre estar atento às condições
higiênicas e sanitárias dos processos de produção e processamento de alimentos, principalmente quanto
às boas práticas de fabricação.The aim of this study was to evaluate the profile of antibiotic resistance in Salmonella isolated from the
carcasses, livers and hearts of chickens slaughtered in the state of Tocantins, Brazil, as recommended
by the Normative Instruction 70 of 2003 of the Ministry of Agriculture, Livestock and Food Supply and
the National Monitoring Program Prevalence and Bacterial Resistance in Chicken. Carcasses, livers
and hearts from chicken with or without pericarditis/perihepatitis were studied in 60 lots of poultry
slaughtered under the Federal Inspection System in the state of Tocantins, Brazil between August 2010
and June 2011. Twenty-six indicative Salmonella sp. were isolated in 11 lots (18.33%). Different strains
of Salmonella were isolated more than a kind of sample/lot. The most frequent serovar was Enteriditis
(38.46%, 10/26), while the second was Mbandaka (19.23%, 5/26), both isolated from hearts, livers
and carcasses. Regarding antimicrobial resistance, of 12 tested principal pharmacological agents, the
samples appeared to be most sensitive to tetracyclines, but showed 100% resistance to one or more
active principal agents, especially sulfamethoxazole (30 mcg) and amoxicillin/clavulanic acid (30 mcg).
Although Salmonella sp. was isolated from normal carcasses, the results are within permitted levels
for unfrozen products according to Brazilian legislation. However, one should always be aware of the
hygienic and sanitary conditions of production processes and food processing, especially regarding
good manufacturing practices
Morphological characterization of vaginal epithelial cells of santa inês ewes subjected to estrus synchronization
Vaginal cytology analysis has been used to evaluate the different stages of estrous cycle of several species; it presents a direct correlation with the animal’s hormonal state and provides essential information about the female reproductive tract conditions. Two staining methods were tested to evaluate the vaginal epithelial cell morphology of nulliparous and multiparous ewes during the estrus period. An intravaginal device impregnated with medroxyprogesterone acetate was kept into 10 nulliparous and 10 multiparous ewes for 14 days for estrus synchronization. Then, the progesterone device was withdrawn, and 300 IU of eCG was administered intramuscularly. Vaginal smears were prepared for posterior staining with Panotico or Giemsa stains when estrus was detected. The cells were classified into nucleated superficial, anucleate superficial, intermediate, parabasal, and basal. The Panotico and Giemsa staining of the different cell types studied were satisfactory. A predominance of intermediate epithelial cells (p<0.05) was found after staining. No difference in percentages of the different types of vaginal epithelial cells between nulliparous and multiparous ewes were found. Therefore, both staining methods were efficient, and a predominance of intermediate cells is found in nulliparous and multiparous ewes during the estrus period