Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Laboratory Innovation to Investigate Concrete Paving Blocks Compressive Strength

This research aims to evaluate the block method against the cube test method using variations in thickness. Paving blocks can be produced using a hydraulic machine or a simple press, and their performance can be measured based on density and compressive strength tests. The block test method shows that with the same material composition forming the paving block, a paving block with a higher thickness can lead to a lower compressive strength value. In contrast, the cube test method shows different results. The paving blocks used in this study had width and length sizes of 100 and 200 mm, respectively, and had varying heights of 60, 80, and 100 mm. The results reveal that the compressive strength of concrete paving blocks is more precise based on density. Furthermore, the empirical equation and conversion coefficient of the compressive strength of the block test to the cube test have been obtained. This empirical equation is highly recommended for the road pavement industry in controlling the quality of compressive strength, even when using block tests. Further research can help develop a formula for using additive materials in paving blocks. Doi: 10.28991/CEJ-2023-09-11-03 Full Text: PD

Impact of alpha-tocopherol deficiency and supplementation on sacrocaudalis and gluteal muscle fiber histopathology and morphology in horses.

BackgroundA subset of horses deficient in alpha-tocopherol (α-TP) develop muscle atrophy and vitamin E-responsive myopathy (VEM) characterized by mitochondrial alterations in the sacrocaudalis dorsalis medialis muscle (SC).ObjectivesTo quantify muscle histopathologic abnormalities in subclinical α-TP deficient horses before and after α-TP supplementation and compare with retrospective (r)VEM cases.AnimalsProspective study; 16 healthy α-TP-deficient Quarter Horses. Retrospective study; 10 retrospective vitamin E-responsive myopathy (rVEM) cases .MethodsBlood, SC, and gluteus medius (GM) biopsy specimens were obtained before (day 0) and 56 days after 5000 IU/450 kg horse/day PO water dispersible liquid α-TP (n = 8) or control (n = 8). Muscle fiber morphology and mitochondrial alterations were compared in samples from days 0 and 56 and in rVEM cases.ResultsMitochondrial alterations more common than our reference range (<2.5% affected fibers) were present in 3/8 control and 4/8 treatment horses on day 0 in SC but not in GM (mean, 2.2; range, 0%-10% of fibers). Supplementation with α-TP for 56 days did not change the percentage of fibers with mitochondrial alterations or anguloid atrophy, or fiber size in GM or SC. Clinical rVEM horses had significantly more mitochondrial alterations (rVEM SC, 13% ± 7%; GM, 3% ± 2%) and anguloid atrophy compared to subclinical day 0 horses.Conclusions and clinical importanceClinically normal α-TP-deficient horses can have mitochondrial alterations in the SC that are less severe than in atrophied VEM cases and do not resolve after 56 days of α-TP supplementation. Preventing α-TP deficiency may be of long-term importance for mitochondrial viability

A Nonsynonymous Change in Adhesion G Protein–Coupled Receptor L3 Associated With Risk for Equine Degenerative Myeloencephalopathy in the Caspian Horse

Equine degenerative myeloencephalopathy (EDM), a neurological disease of young horses, causes progressive development of symmetric ataxia predominantly in the pelvic limbs. Equine degenerative myeloencephalopathy is likely inherited and with no known treatment affected horses frequently need euthanasia. Alpha-tocopherol deficiency during early life appears to contribute to the phenotype. This study sought to identify any genetic variants correlated with EDM in Caspian foals. Two half-sibling EDM-diagnosed cases were genotyped at 52,063 loci and evaluated by the Autozygosity by Difference statistic. Additional horses not affected by EDM were used for genetic comparison to identify regions unique to the case phenotype. The associated region on chromosome 3 contains only one gene encoding adhesion G protein–coupled receptor L3 (ADGRL3). Adhesion G protein–coupled receptor L3 is a member of the latrophilin subfamily of G protein–coupled receptors and may contribute to attention deficit/hyperactivity disorder in humans and hyperactive motor function in mice and zebrafish. Analysis of the predicted coding regions for Equine ADGRL3 in affected horses revealed a nonsynonymous single nucleotide polymorphism at Chr3:71,917,591 bp. Caspian and Caspian cross-relatives (n = 81) of the two initial cases and unrelated horses from similar breeds (n = 130, including Arabians, American Miniatures, and Shetlands) possessed this allele at 5% frequency, with no homozygotes observed within the non-Caspian breeds. This study suggests that a polymorphism in ADGRL3 could contribute to a genetic predisposition to Caspian horse EDM

"Adopt-a-Tissue" Initiative Advances Efforts to Identify Tissue-Specific Histone Marks in the Mare

International audienc

Killing-Yano tensors and some applications

The role of Killing and Killing-Yano tensors for studying the geodesic motion of the particle and the superparticle in a curved background is reviewed. Additionally the Papadopoulos list [74] for Killing-Yano tensors in G structures is reproduced by studying the torsion types these structures admit. The Papadopoulos list deals with groups G appearing in the Berger classification, and we enlarge the list by considering additional G structures which are not of the Berger type. Possible applications of these results in the study of supersymmetric particle actions and in the AdS/CFT correspondence are outlined.Comment: 36 pages, no figure