Identificação de fungos em linhaça ( Linum usitatissimum ) utilizando as regiões ITS1 e ITS2 do gene ITS

TCC (graduação) - Universidade Federal de Santa Catarina. Centro de Ciências Agrárias. Ciência e Tecnologia de Alimentos.A semente de linhaça (Linum usitatissimum L.) é conhecida por suas propriedades funcionais e presença de ácido α-linolênico (ômega-3). Contém ainda fibra solúvel e insolúvel, lignanas, ácidos fenólicos, flavonoides, ácido fítico, vitaminas e minerais. Todavia, a microbiota deste alimento pode ser foco de contaminação fúngica, interferindo na qualidade final. O objetivo deste trabalho foi identificar os fungos presentes em linhaça a granel através do gene ITS em uma abordagem metagenômica. A identificação fúngica foi realizada utilizando-se o sequenciamento de alto desempenho da região ITS1 usando os primers ITS1 (GAACCWGCGGARGGATCA) e ITS2 (GCTGCGTTCTTCATCGATGC) com 300 ciclos e sequenciamento single-end no equipamento MiSeq Sequencing System (Illumina Inc., USA). Foram encontrados seis gêneros e oito espécies de fungos na amostra de linhaça dourada analisada. O gênero Aspergillus se destacou com três espécies xerofílicas encontradas, A. cibarius, A. Appendiculatus e A. amstelodami. Aspergillus cibarius foi a mais abundante, porém não produz toxinas. O segundo gênero mais abundante foi Wallemia, com a espécie W. muriae. Este é um dos táxons de fungos com grande potencial xerofílico, sendo que algumas cepas podem produzir toxinas. A metagenômica revelou ser um método completo, rápido e eficiente, principalmente quando comparado a outros métodos como por exemplo, o de cultivo tradicional exercido em laboratório. O sequenciamento genético de alto desempenho é um importante aliado nas pesquisas, com o avanço tecnológico relacionado a segurança dos alimentos.Flaxseed (Linum usitatissimum L.) is known for its functional properties and presence of α linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins and minerals. However, the microbiota of this food can be the focus of fungal contamination, interfering with the final quality. The objective of this work was to identify the fungi present in bulk flaxseed through the ITS1 gene by using a metagenomics approach. Fungal identification was performed using the high performance sequencing of the ITS1 region using the ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., USA). Six genera and eight species of fungi were found in the golden linseed sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus and A. amstelodami. Aspergillus cibarius was the most abundant, but it does not produce toxins. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins (Walleminol and Walleminon). Metagenomics has proved to be a complete, fast and efficient method, especially when compared to other methods, such as traditional cultivation performed in the laboratory. High-performance genetic sequencing is an important ally in research, with technological advances related to food safety

Obstáculos legais à restituição e repatriação de bens culturais : perspectivas atuais no Direito Internacional

A remoção dos bens culturais durante tempos de conflito, como espólios de guerra, é um fenômeno imemorial. Recentemente, os pedidos de repatriação e a restituição desses bens angariaram atenção internacional. Diante deste cenário, têm se observado iniciativas voluntárias de devolução por parte dos detentores. Contudo, verifica-se a existência de diversos obstáculos legais, que contribuem para a insegurança jurídica dos demandantes. O presente trabalho pretende identificar os principais entraves legais, no contexto do direito internacional, para a retorno dos bens culturais saqueados durante o período colonial no continente africano e confiscados pelo Partido Nazista na Segunda Guerra Mundial. A partir deste recorte específico, objetiva analisar as bases legais favoráveis ou desfavoráveis à devolução. De forma secundária, visa examinar as causas das demandas, através da compreensão do contexto histórico, e explorar as alternativas utilizadas pelos demandantes para a efetivação das devoluções, em especial a negociação bilateral. Para isto, a metodologia utilizada é a hipotético-dedutiva, através do estudo de casos, revisão de literatura, e da consulta de bibliografia, bancos de dados, leis, tratados internacionais, jurisprudência e relatórios. Concluiu-se que o Direito Internacional não apresenta respostas satisfatórias aos pedidos, tendo em vista a limitação das normas vigentes. O processo restitutório é disruptivo e assimétrico, considerando as partes envolvidas. Diante da ausência de leis internacionais capazes de operacionalizar as devoluções, passíveis de implementação pelos países das disputas, é necessária a elaboração de soluções adequadas para as demandas, atentas às dificuldades dos casos concretos.The removal of cultural goods during times of conflict, as spoils of war, is an immemorial phenomenon. Recently, the requests for repatriation and restitution of these goods have gathered international attention. In this scenario, voluntary devolutions have been observed by their holders. However, the existence of several legal obstacles has also been noticed, which contributes to the legal uncertainty by the plaintiffs. This paper intends to identify the main legal barriers, in the international law context, to the restitution of the cultural goods plundered during the colonial period in the African Continent, and the goods confiscated by the Nazi Party during the Second World War. Through this particular outline, it is intended to analyze the legal basis that are favorable or unfavorable to devolution. Secondly, this paper aims to examine the cause for these demands, by understanding the historical context, and explore the alternatives used by the plaintiffs to guarantee the effectiveness of the devolutions, in particular, the use of bilateral negotiations. For that, the methodology that is used is the hypothetic-deductive, using case studies, literary revision, and the consultation bibliography, data basis, laws, international treaties, case law and reports. It was concluded that International Law does not propose satisfactory answers to these requests, in lieu of the limitations of current legal norms. The restitutive process is disruptive and asymmetrical, considering the parties involved. In face of this absence of international laws that are capable of making these devolutions operational, in a way that can be implemented by the countries where these disputes take place, the development of adequate solutions is necessary, taking into account the difficulties posed by the concrete cases

Movimentação e área de uso de adultos de Peltocephalus dumerilianus (Testudines, Podocnemididae) na Reserva Biológica do Rio Trombetas, Pará

The study of individual’s movements is important to understand the life history of the animals and to promote strategies for management and conservation of species. Peltocephalus dumelirianus’s movements had a significant relationship with the water temperature and the hydrological cycle stages in which individuals move more during the ebb of the Trombetas river and less during drought. The size of land use and movement of individuals showed no differences between the sexes and the carapace length did not influence the results. P. dumerilianus showed a restricted area of use during the period of study and it is concluded that the maintenance of species is very necessary to preserve the habitat.O estudo da movimentação dos indivíduos é importante para compreender a história de vida dos animais e para fomentar estratégias de manejo e conservação das espécies. A movimentação de Peltocephalus dumelirianus teve relação significativa com a temperatura da água e com os estágios do ciclo hidrológico na qual os indivíduos se movimentam mais durante a vazante do rio Trombetas e menos durante a seca. O tamanho da área de uso e a movimentação dos indivíduos não mostraram diferenças entre os sexos e o comprimento da carapaça não influenciou os resultados. P. dumerilianus apresentou uma área de uso restrita durante o período de estudo e se conclui que para a manutenção da espécie é extremamente necessário a preservação do habitat

Topographic analysis of mandibular ramus zone and anesthetic technique optimizing device

This is a study on the topographic relationship between the final extremity of the lingula of the mandible and the anterior and posterior borders of the ramus of the mandible. This work proposes the creation of a device which directs the positioning of the syringe cartridge + needle assembly, optimizing the execution of the anesthetic technique for blocking the inferior alveolar nerve. Thirty macerated adult mandibles were used, in which two measurements were obtained with the aid of a digital caliper: 1- distance between the anterior border of the mandibular ramus and the final extremity of the lingula; 2- distance between the final extremity of the lingula and the posterior border of the mandibular ramus. Photographs of the mandibles were analyzed on a computer, calculating the angle formed between three points: (1) the anterior border of the mandibular ramus – A point; (2) the anterior point between the inferior premolars of the opposite antimere – P point and (3) the final extremity of the lingula – L point. For the right antimere, 33.33% of the angles found were within the range of 6°-7°, and 23.33% between 9°-10°. As for the left, 30.00% were in the range between 5°-6°, and 23.33% between 7°-8°. It can be concluded that in more than 50% of the analyses, the formed angle varies predominantly between 5° and 10°, therefore, the proposed device will be able to minimize the chances of technical errors and optimize the success for the inferior alveolar nerve block

Alternative potency tests for quality control of immunobiologicals: a critical review of the validation approach

Introduction: In addition to low reproducibility, in vivo potency tests used in the quality control of immunobiological products require too many animals, causing them significant pain and suffering. In the last decades, many studies have been conducted to validate alternative methods for quality control and batch release of products such as vaccines and other immunobiologicals, especially for potency tests. Objective: To discuss validation studies on alternative methods proposed for replacing the in vivo potency tests and the used statistical approach, as well as to propose harmonization of terminology and to design validation studies for alternative potency methods. Method: A review of scientific databases was carried out to compile the products, data on the validation procedures and to verify their inclusion in the pharmacopeias. Results: Four trials were incorporated into the pharmacopeias. Statistical approaches included mainly regression assessment, ANOVA and Chi-square test. Conclusions: It is a challenge to conduct appropriate validation studies that are widely accepted by regulatory authorities, especially where validation centers have not yet been established. A clear indicator of this difficulty was the low number of methods for biological products incorporated into the guidelines.TÍTULO PT: Testes de potência alternativos para controle de qualidade de imunobiológicos: revisão crítica da abordagem de validação Introdução: Os ensaios de potência in vivo utilizados no controle da qualidade de imunobiológicos requerem o uso de muitos animais, e além da baixa reprodutibilidade, causam dor e sofrimento significativos. Nas últimas décadas, muitos estudos foram desenvolvidos para validar métodos alternativos para o controle da qualidade e liberação de lotes de produtos como vacinas e outros imunobiológicos, especialmente para os testes de potência. Objetivo: Discutir os estudos de validação sobre métodos alternativos para substituir ensaios de potência in vivo, a abordagem estatística utilizada e propor a harmonização da terminologia e o desenho para os estudos de validação de métodos alternativos de potência. Método: Uma pesquisa de revisão foi realizada em bases de dados científicos para compilar os produtos e dados dos procedimentos de validação, verificando sua inclusão nas farmacopeias. Resultados: Quatro ensaios foram incorporados em farmacopeias. As abordagens estatísticas incluíram principalmente a avaliação da regressão, ANOVA e teste de Qui-quadrado. Conclusões: É um desafio realizar estudos de validação adequados que sejam amplamente aceitos pelas autoridades reguladoras, especialmente onde os centros de validação ainda não foram estabelecidos. Um indicador claro dessa dificuldade foi o baixo número de métodos para produtos biológicos incorporados nas diretrizes