Testing the surface fixation method in gestational diabetes mellitus

Introduction: To test the surface fixation method contrasting urine samples of women with GDM vs healthy pregnant women. Methods: This was a pilot descriptive study. Three groups were conformed: A) Pregnant women with GDM, B) Women with healthy pregnancies and C) Non-pregnant healthy women. The positiveness of the surface fixation method was contrasted with Odds Ratio. Results: 12 women with GDM, 14 with healthy pregnancies and 9 non-pregnant women were included in the study. The OR for a positive surface fixation test when contrasting GDM vs Healthy pregnancies was of 2.7 while the value when contrasting GDM vs Healthy pregnancies + Non pregnant women was of 3.2 without reaching significant statistical difference in any case. Conclusion: the surface fixation method used with urine samples, suggests the existence of a transient antigen-antibody reaction that contributes to the inefficient insulin secretion

Impact of simulated microgravity conditions on bacterial cell-cell communication utilizing Vibrio fischeri

For bacteria to thrive in stressful environments, they must communicate with one another through Quorum Sensing (QS), or chemical signals released to the environment. QS allows bacteria to sense the environment and regulate their cell number and behavior by adjusting their gene expression. This ability is made possible by the production of small chemical molecules called autoinducers (AI). The space environment is known for being a stressful place for bacteria due to space radiation and microgravity (µG). Past research in space has shown that bacteria become more virulent and resistant to antibiotics. By learning the functionality of AIs, new methods to control bacteria outbreaks can be achieved that block these chemical signals. This research project aims to improve the understanding of bacterial QS processes to describe what types of autoinducers are synthesized under simulated µG compared to earth gravity (g). This project will utilize a microgravity analog developed in the Space Microbiology Lab at ERAU. Detecting the AIs will be completed by using genetically modified bacteria, known as “biosensors”, which will luminesce if they find autoinducers produced by the model organism (Vibrio fischeri). Three types of autoinducers (responsible for virulence-related phenotypes) will be detected utilizing this method. To detect each AI, three genetically modified non-pathogenic bacterial strains were selected. The goal of this experiment will be to observe the florescence change of the biosensors between µG and g

Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator-activated Receptor Gamma Promoter Region (-359 to -260) Methylation in the Neonate

Background: Obesity in pregnancy can contribute to epigenetic changes. Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes. Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.). Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260). Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.Acknowledgments Authors thank the National Council of Science and Technology (CONACYT), México, for the MSc. Scholarship awarded to Ruth Elizabeth Casamadrid Vázquez and Maggie Brunner M.A., for her excellent help with the English style correction. Financial support and sponsorship National Council of Science and Technology (CONACYT), Mexico and Asociación Científica Latina A.C (ASCILA)

Effects of Long-term Exposure to Microgravity Conditions on Bacterial Communities

Bacteria exposed to the spaceflight environment have been proven to show profound phenotypic changes, including increase resistance to antibiotics, increased bacterial community formation and increased resistance to environmental stresses, just to mention a few. To more fully characterize the space-flight induced conditions, we have performed a long-term experiment consisting in monitoring growth of multiple bacterial species (Escherichia coli, Lactococcus lactis and Staphylococcus salivarious) using a 2D clinostat design that simulates microgravity conditions. All bacterial species were grown in microcosms under gravity and microgravity in an effort to simulate microbiome communities. Bacteria were collected and tested for competition studies and for multiple cell phenotypes, including cell morphology, susceptibility to chemical and physical stressors and virulence-related phenotypes such as biofilm formation and antibiotic susceptibility. Possible interactions between cells grown in the artificial microbiome will help us to understand alterations of human bacterial communities during space travel

Differential Gene Expression in Escherichia Coli Chronically Exposed to Simulated Microgravity

Exposure to simulated microgravity changes the physiology and gene expression in bacteria. We used a set of Escherichia coli strains grown in a 2D clinostat for up to 24 days to measure the differential expression of a series of biofilm and pH and oxidative stress response-related genes using RT-qPCR. For this purpose, we grew E. coli from glycerol stocks at 30 C in nutrient broth for 24 h. The cells were then separated from the media and resuspended in an RNA preservative to stop metabolic activity and maintain the integrity of the RNA. We then extracted the RNA and synthesized cDNA in preparation for real-time PCR. We amplified segments of genes that had previously shown regulated on a transcriptome analysis and used them as markers to study their differential expression in cells grown from four distinct timepoints during the microgravity experiment. Our results show that some of the genes were either up or downregulated in response to simulated microgravity, suggesting that the constant free-falling or weightlessness state created by our microgravity analog changes transcriptional events in bacteria

A comparison of classification models to detect cyberbullying in the Peruvian Spanish language on twitter

Cyberbullying is a social problem in which bullies’ actions are more harmful than in traditional forms of bullying as they have the power to repeatedly humiliate the victim in front of an entire community through social media. Nowadays, multiple works aim at detecting acts of cyberbullying via the analysis of texts in social media publications written in one or more languages; however, few investigations target the cyberbullying detection in the Spanish language. In this work, we aim to compare four traditional supervised machine learning methods performances in detecting cyberbullying via the identification of four cyberbullying-related categories on Twitter posts written in the Peruvian Spanish language. Specifically, we trained and tested the Naive Bayes, Multinomial Logistic Regression, Support Vector Machines, and Random Forest classifiers upon a manually annotated dataset with the help of human participants. The results indicate that the best performing classifier for the cyberbullying detection task was the Support Vector Machine classifier

Iron profile and hepcidin associated with oxidative stress and metabolic disturbances in pregnancy

Background: A common problem during pregnancy is anemia and to reduce its prevalence the WHO and national guidelines recommend a prescription of 30 to 60 mg of iron/day. The aim of this study was to evaluate the association of iron profile, hepcidin and oxidative stress in pregnant women prescribed with iron as a probable cause of metabolic disorders. Method: In this cohort study two groups were followed: A) women with low-risk pregnancy (WLRP), B) women with high-risk pregnancy (WHRP): women with metabolic disorders (dyslipidemias, GDM and high blood pressure). Oxidative stress enzymes, iron profile and hepcidin were measured in the second and third trimesters. Results: There were significant differences in hepcidin levels between WLRP and WHRP in 2nd (3.6 ± 4.2 vs 4.69 ± 3.23 P=0.005) and 3rd trimester (3.65 ± 3.44 vs 6.84 ± 5.14 P=0.02). The serum iron concentration had a negative relationship with catalase (-0.599; P=0.04) and a positive relationship with glutathione peroxidase (0.729; P=0.007). Conclusion: The iron serum levels increase could induce oxidative damage in pregnancy. Increased hepcidin is a useful biomarker for determining iron availability in pregnancy and its association with antioxidant systems

Assessing bacterial quorum sensing through measuring bioluminescence with Vibrio fischeri exposed to simulated microgravity

Bacteria flourish in stressful environments when communicating with each other in a process known as Quorum Sensing. This process is accomplished by the production of small signaling molecules referred to as Autoinducers (AI). This communication allows the bacteria to alter their gene expression in an effort to regulate their cell number, behavior and sense the surrounding environment. The space environment provides stressful conditions for bacteria as they are exposed to radiation and microgravity (µG). Because of this, it could be possible that bacteria become more virulent and resistant to antibiotics. The purpose of this research was to expose Vibrio fischeri to simulated microgravity for its ability to produce AI and measure their quantity. The methods used include measurement of fluorescence via microbial biosensors (genetically modified microorganisms) that activate gene expression of markers once a specific autoinducer is detected, readings are recorded (using a microplate reader) and graphed. Results have demonstrated increased AI production and altered colony morphology under simulated microgravity

Aplicación de la herramienta de la 5`s para la mejora en la productividad del almacén de la empresa “Casa Olivera S.R.L” ubicada en Chorrillos, Lima - Perú 2015 - 2016

La presente investigación titulada: “Aplicación de la herramienta de la 5`s para la mejora en la productividad del almacén de la empresa Casa Olivera S.R.L, ubicada en Chorrillos, Lima 2015 – 2016”, tuvo como objetivo determinar como la aplicación de la herramienta de las 5’S mejora la productividad en el Almacén de la empresa Casa Olivera S.R.L, ubicada en Chorrillos, Lima 2015 – 2016. Esto como respuesta al problema: ¿De qué manera la Aplicación de la herramienta de las 5`S mejora la productividad en el almacén de la empresa Casa Olivera S.R.L, ubicada en chorrillos, lima 2015 – 2016? La investigación se desarrollo bajo un diseño cuasi-experimental, con enfoque cuantitativo, en el cual la muestra estuvo conformada por 34 pedidos. Para mejorar la información requerida, previamente se validaron los instrumentos y se demostró la validez y confiabilidad, mediante la técnica juicio de expertos; la Técnica que se empleo fue fichas de observación y el instrumento fue cronometro digital. Con referencia al objetivo general: Determinar como la aplicación de la Herramienta de 5’S mejora la productividad en el Almacén de la empresa Casa Olivera S.R.L, ubicada en chorrillos, lima 2015 – 2016, se concluye que; hay una diferencia significativa en las medias de la productividad antes y después de aplicar la herramienta de las 5’S. Por los cual se concluye que hay una mejora de la productividad en el almacén, aplicando la herramienta de las 5’s. De hecho la productividad en promedio incremento de 9,71% a 15,99%