1,975 research outputs found
Computer simulation of the microstructure and rheology of semi-solid alloys under shear
The rheological behavior of metallic alloys containing both solid and liquid
phases is investigated in the low solid fraction range (<50%). This behavior
depends on both the solid fraction and the shear rate. The concept of Effective
Volume Fraction (EVF) is used to decorrelate the influence of these two
parameters. At high shear rate the slurry behaves like a suspension of hard
spheres, whereas at lower shear rate, particles tend to aggregate in clusters,
entrapping liquid and thus, increasing the EVF and the viscosity. A lattice
model is introduced to simulate the aggregation / break-up processes within a
slurry under shear. When the steady state is reached, the entrapped liquid
fraction is calculated, leading to a viscosity estimation. Simulation results
for the viscosity and 3D cluster structure are in good agreement with
experimental results.Comment: 30 pages, 17 figures, to be published in Acta Mate
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe
Effects of ionizing radiation on charge-coupled imagers
The effects of ionizing radiation on three different charge coupled imagers have been investigated. Device performance was evaluated as a function of total gamma ray dose. The principal failure mechanisms have been identified for each particular device structure. The clock and bias voltages required for high total dose operation of the devices are presented
Late harvest as factor affecting esca and Botryosphaeria dieback prevalence of vineyards in the Alsace region of France
The decline of grapevines due to esca and Botryosphaeria dieback (Bot. dieback) is a serious problem in the Alsace region of France. A survey of 82 vineyards over 8 years showed that among a set of agronomical and cultural variables, esca and Bot. dieback prevalence correlated to the harvest dates, especially late harvest dates for the production of sweet wines. The interpretation of this finding that points to the carbon balance of the vine and its reserves status as possible causation is discussed. Under this hypothesis the data also point to climatic variables as factors in the disease epidemiology, with a lag phase of about one year.
Task based profiles of language impairment in Parkinson’s Disease
This study aimed to add to our understanding of language impairment in people with Parkinson's Disease (PwPD). Language difficulties are increasingly reported in PD. However, there are contradictory reports on how they relate to motor and cognitive impairment. In addition, the link between various language deficits or the same deficits across task modalities is not well understood. This lack of understanding impacts on clinicians’ ability to assess and effectively treat language impairment in PD. Our study therefore aimed to investigate language performance across a number of task structures and correlate this performance with cognitive skills, as well as motor and speech performance. The study included 22 German speaking PwPD and 22 matched healthy control participants. 18 participants in each group were cognitively healthy and four had mild cognitive impairment. They performed a number of executive function and language tasks of different complexity and structure. The linguistic investigation focused on grammatical accuracy and complexity, linguistic content as well as articulatory features. There were few cognitive differences between the two groups, with only set-shifting as an executive function being significantly reduced in PwPD, but grammatical error rate was higher in PwPD than in their healthy controls across all language tasks. This was linked to set shifting skills but only for the complex grammar condition, not for more naturalistic language tasks. Furthermore, there was no correlation of language performance across the task levels, i.e. error rates in the structured task did not predict naturalistic performance. Motor and dysarthria severity could not predict language impairment either. This study confirms the presence of language problems in PwPD in the absence of global cognitive impairment or only MCI, and at the same time establishes a task based relationship between the two skills. From a clinical perspective the data indicate that structured tests are unable to accurately predict naturalistic language performance, highlighting the need for functional assessments rather than relying on fast scoring structured tests, at least at early disease stages. In addition, the impact of the individual language difficulties needs to be explored to establish appropriate and effective treatment pathways
Comparative analysis of viral shedding in pediatric and adult subjects with central nervous system-associated enterovirus infections from 2013 to 2015 in Switzerland.
Several enterovirus (EV) genotypes can result in aseptic meningitis, but their routes of access to the central nervous system remain to be elucidated and may differ between the pediatric and adult populations.
To assess the pattern of viral shedding in pediatric and adult subjects with acute EV meningitis and to generate EV surveillance data for Switzerland.
All pediatric and adult subjects admitted to the University Hospitals of Geneva with a diagnosis of EV meningitis between 2013 and 2015 were enrolled. A quantitative EV real-time reverse transcriptase (rRT)-PCR was performed on the cerebrospinal fluid (CSF), blood, stool, urine and respiratory specimens to assess viral shedding and provide a comparative analysis of pediatric and adult populations. EV genotyping was systematically performed.
EV positivity rates differed significantly between pediatric and adult subjects; 62.5% of pediatric cases (no adult case) were EV-positive in stool and blood for subjects for whom these samples were all collected. Similarly, the EV viral load in blood was significantly higher in pediatric subjects. Blood C-reactive protein levels were lower and the number of leucocytes/mm3 in the CSF were higher in non-viremic than in viremic pediatric subjects, respectively. A greater diversity of EV genotypes was observed in pediatric cases, with a predominance of echovirus 30 in children ≥3 years old and adults.
In contrast to adults, EV-disseminated infections are predominant in pediatric subjects and show different patterns of EV viral shedding. This observation may be useful for clinicians and contribute to modify current practices of patient care
Direct association between rainfall and non-typhoidal <i>Salmonella</i> bloodstream infections in hospital-admitted children in the Democratic Republic of Congo
Abstract Non-typhoidal Salmonella (NTS) ranks first among causes of bloodstream infection in children under five years old in the Democratic Republic of Congo and has a case fatality rate of 15%. Main host-associated risk factors are Plasmodium falciparum malaria, anemia and malnutrition. NTS transmission in sub-Saharan Africa is poorly understood. NTS bloodstream infections mostly occur during the rainy season, which may reflect seasonal variation in either environmental transmission or host susceptibility. We hypothesized that environment- and host-associated factors contribute independently to the seasonal variation in NTS bloodstream infections in children under five years old admitted to Kisantu referral hospital in 2013–2019. We used remotely sensed rainfall and temperature data as proxies for environmental factors and hospital data for host-associated factors. We used principal component analysis to disentangle the interrelated environment- and host-associated factors. With timeseries regression, we demonstrated a direct association between rainfall and NTS variation, independent of host-associated factors. While the latter explained 17.5% of NTS variation, rainfall explained an additional 9%. The direct association with rainfall points to environmental NTS transmission, which should be explored by environmental sampling studies. Environmental and climate change may increase NTS transmission directly or via host susceptibility, which highlights the importance of preventive public health interventions
- …