On the relationship between the “default mode network” and the “social brain”

The default mode network (DMN) of the brain consists of areas that are typically more active during rest than during active task performance. Recently however, this network has been shown to be activated by certain types of tasks. Social cognition, particularly higher-order tasks such as attributing mental states to others, has been suggested to activate a network of areas at least partly overlapping with the DMN. Here, we explore this claim, drawing on evidence from meta-analyses of functional MRI data and recent studies investigating the structural and functional connectivity of the social brain. In addition, we discuss recent evidence for the existence of a DMN in non-human primates. We conclude by discussing some of the implications of these observations

Temperature dependence of surface reconstructions of Au on Pd(110)

Surface reconstructions of Au film on Pd(110) substrate are studied using a local Einstein approximation to quasiharmonic theory with the Sutton-Chen interatomic potential. Temperature dependent surface free energies for different coverages and surface structures are calculated. Experimentally observed transformations from $(1\times1)$ to $(1 \times 2)$ and $(1 \times 3)$ structures can be explained in the framework of this model. Also conditions for Stranski-Krastanov growth mode are found to comply with experiments. The domain of validity of the model neglecting mixing entropy is analyzed.Comment: 7 pages, REVTeX two-column format, 3 postscript figures available on request from [email protected] To appear in Phys. Rev. Letter

A Characterisation of Strong Wave Tails in Curved Space-Times

A characterisation of when wave tails are strong is proposed. The existence of a curvature induced tail (i.e. a Green's function term whose support includes the interior of the light-cone) is commonly understood to cause backscattering of the field governed by the relevant wave equation. Strong tails are characterised as those for which the purely radiative part of the field is backscattered. With this definition, it is shown that electromagnetic waves in asymptotically flat space-times and fields governed by tail-free propagation have weak tails, but minimally coupled scalar fields in a cosmological scenario have strong tails.Comment: 17 pages, Revtex, to appear in Classical and Quantum Gravit

Development of 10 microsatellite loci in the wolf spider Arctosa sancterosae (Araneae: Lycosidae)

Abstract Ten novel microsatellite loci were isolated from Arctosa sancterosae, a white dune dwelling species of wolf spider. Diversity was assessed in 273 individuals sampled from 11 populations along the Northern coast of the Gulf of Mexico. These new genetic markers will be useful for the description and conservation of these limited populations. Keywords Arachnids Á Coastal dune ecosystem Á Microsatellites Á Enriched library The white beach spider, Arctosa sancterosae, is a burrowing wolf spider endemic to the dune ecosystem of the northern coast of the Gulf of Mexico (NGC). Species endemic to this ecosystem are ideal for examining the effects of disturbance (e.g. hurricanes, habitat fragmentation/degradation) on population persistence. It is widely recognized that the primary threat to these populations is habitat fragmentation, but with the reduced gene flow associated with anthropogenic habitat modification and a predicted increase in the intensity of tropical storms We developed 10 novel microsatellite loci using the enrichment protocol of Glenn and Schable 2005. Whole genomic DNA was extracted from the legs of A. sancterosae using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA concentration was determined using a spectrophotometer and genomic DNA was then digested with the restriction enzymes RsaI and XmnI to yield fragments between 300 and 1,000 bp long. To the ends of these fragments we then ligated SuperSNX24 linkers (F; GTTTAAGG CCTAGCTAGCAGAATC, R; GATTCT GCTAGCTAGGCCTTAAACAAAA) and a polymerase chain reaction was performed to ensure ligation was successful. Genomic fragments were enriched using a probe mix containing four biotinylated oligonucleotides (AAT 10 , AAAT 7 , AAC 6 and AGAT 8 ) and separated with streptavidin magnetic beads. This mixture was washed with a 29 SSC, 0.1% SDS solution twice and a 19 SSC, 0.1% SDS solution four times. A magnetic particle collector was used between washes to capture the magnetic beads. After the last wash, fragments were removed from the probes by denaturing at 95°C for 5 min and precipitating with 95% ethanol and 3 M sodium acetate. These fragments were then air-dried and resuspended in 25 lL of TLE. To increase the quantity of these recovered enriched DNA we amplified the enriched pool by PCR using the SuperSNX24-F primer. These amplified fragments were then transformed and cloned using a TOPO TA Cloning Kit (45-0641). Blue-white selection revealed 288 clones that were then screened for inserts suitable (large enough) for microsatellite development by PCR using M13 forward and reverse primer

Scaling of Self-Avoiding Walks in High Dimensions

We examine self-avoiding walks in dimensions 4 to 8 using high-precision Monte-Carlo simulations up to length N=16384, providing the first such results in dimensions $d > 4$ on which we concentrate our analysis. We analyse the scaling behaviour of the partition function and the statistics of nearest-neighbour contacts, as well as the average geometric size of the walks, and compare our results to $1/d$-expansions and to excellent rigorous bounds that exist. In particular, we obtain precise values for the connective constants, $\mu_5=8.838544(3)$, $\mu_6=10.878094(4)$, $\mu_7=12.902817(3)$, $\mu_8=14.919257(2)$ and give a revised estimate of $\mu_4=6.774043(5)$. All of these are by at least one order of magnitude more accurate than those previously given (from other approaches in $d>4$ and all approaches in $d=4$). Our results are consistent with most theoretical predictions, though in $d=5$ we find clear evidence of anomalous $N^{-1/2}$-corrections for the scaling of the geometric size of the walks, which we understand as a non-analytic correction to scaling of the general form $N^{(4-d)/2}$ (not present in pure Gaussian random walks).Comment: 14 pages, 2 figure

Modulation of Mcl-1 sensitizes glioblastoma to TRAIL-induced apoptosis

Glioblastoma (GBM) is the most aggressive form of primary brain tumour, with dismal patient outcome. Treatment failure is associated with intrinsic or acquired apoptosis resistance and the presence of a highly tumourigenic subpopulation of cancer cells called GBM stem cells. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) has emerged as a promising novel therapy for some treatment-resistant tumours but unfortunately GBM can be completely resistant to TRAIL monotherapy. In this study, we identified Mcl-1, an anti-apoptotic Bcl-2 family member, as a critical player involved in determining the sensitivity of GBM to TRAIL-induced apoptosis. Effective targeting of Mcl-1 in TRAIL resistant GBM cells, either by gene silencing technology or by treatment with R-roscovitine, a cyclin-dependent kinase inhibitor that targets Mcl-1, was demonstrated to augment sensitivity to TRAIL, both within GBM cells grown as monolayers and in a 3D tumour model. Finally, we highlight that two separate pathways are activated during the apoptotic death of GBM cells treated with a combination of TRAIL and R-roscovitine, one which leads to caspase-8 and caspase-3 activation and a second pathway, involving a Mcl-1:Noxa axis. In conclusion, our study demonstrates that R-roscovitine in combination with TRAIL presents a promising novel strategy to trigger cell death pathways in glioblastoma. Electronic supplementary material The online version of this article (doi:10.1007/s10495-013-0935-2) contains supplementary material, which is available to authorized users

Optimizing tuning masses for helicopter rotor blade vibration reduction including computed airloads and comparison with test data

The development and validation of an optimization procedure to systematically place tuning masses along a rotor blade span to minimize vibratory loads are described. The masses and their corresponding locations are the design variables that are manipulated to reduce the harmonics of hub shear for a four-bladed rotor system without adding a large mass penalty. The procedure incorporates a comprehensive helicopter analysis to calculate the airloads. Predicting changes in airloads due to changes in design variables is an important feature of this research. The procedure was applied to a one-sixth, Mach-scaled rotor blade model to place three masses and then again to place six masses. In both cases the added mass was able to achieve significant reductions in the hub shear. In addition, the procedure was applied to place a single mass of fixed value on a blade model to reduce the hub shear for three flight conditions. The analytical results were compared to experimental data from a wind tunnel test performed in the Langley Transonic Dynamics Tunnel. The correlation of the mass location was good and the trend of the mass location with respect to flight speed was predicted fairly well. However, it was noted that the analysis was not entirely successful at predicting the absolute magnitudes of the fixed system loads

'In the wake of a pandemic': dietary patterns and impact on child health after COVID-19

INTRODUCTION Our companion Report: ‘Emerging Dietary Patterns: Impact on Child Health’ discussed ways in which traditional dietary patterns in both the UK and internationally were changing. In concluding we argued that: ‘The interconnected nature of food, climate and health is the biggest challenge we face, but therein also lies its strength and boundless potential should we act with the necessary urgency, creativity and commitment. It is at the local level – supported by national policy – that the largest returns from such pro-activity will accrue.’ We continued: ‘The food that we eat here and now can change the world.’ adding: ‘If we are serious about protecting and restoring natural environments, safeguarding the health and wellbeing of our children today and restoring and protecting that of future generations, then there is only one solution. We must change it.’ Then came Covid-19 and change was imposed – with the arrival and experience of a pandemic. The full outcome of Covid-19; its effects and repercussions not just for the present generations but for the many that will succeed it cannot be estimated now. In the 102 years since Spanish ‘flu devastated an older world order, we are still learning its lessons today. But what has become immediately apparent is that what we eat and how we eat has undergone a revolution in four short months. 6 ‘Coronavirus pandemic will change the food industry and eating habits forever, says CEO of Food and Drink Federation, Ian Wright.’ ([email protected] 7 April 2020) ‘To prevent the next pandemic we must take on factory farming.’ (Jonathan Safran Foer and Aaron Gross, The Guardian, 21 April 2020.) ‘Covid-19 will definitely be an accelerator on the conscious consumer patterns that we see unfolding. As the consumer gets more conscious, we also see more interest in sustainable, locally produced food systems solutions.’ (David Brandes, Food Navigator, 17 April 2020.) ‘The virus is a warning that Britain’s food system must change,’ (‘The Guardian,’ 18th April 2020). It would also be unjust to address the Covid-19 pandemic in isolation without highlighting its interactions with another global force to become manifest in the same era in response to an incident in the US; namely, the police killing of George Floyd and the Black Lives Matter Movement. Pandemics, poor health, systemic inequalities and a lack of environmental protections harm black, ethnic minority and disadvantaged communities in all countries more than any other groups, and the two events have shed a harsh light on those realities and their frightening interconnections – such as the higher death rate in BAME communities including healthcare workers on the frontline (Public Health England, June 2020, ‘Beyond the data: Understanding the impact of COVID-19 on BAME groups’): https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/892376/COVID_stakeholder_engagement_synthesis_beyond_the_data.pdf Therefore, to address fall-out from the pandemic without considering these marginalised groups would be inappropriate; to address the environmental crisis without considering its impact on such groups would be pointless and the separation of civil rights from health and environmental policy is delusional. The silos in which policy-making still exists in these fields are stubborn obstacles to change. Both within and without the UK’s boundaries, the diverse spectrum of peoples requires a similar diversity and inclusion in the systems that sustain life – and the production of the food that is eaten in order to live. Sometimes change is immediate and imposed rather than incremental and the pandemic has seen an abrupt conclusion to familiar and traditional ways of living. As we offer our thoughts about the many ways in which Covid-19 has changed our dietary patterns, we must remember that the ‘brave new world’ of our future ambition ‘has such people in it’, (‘The Tempest’, William Shakespeare). Those who would construct better dietary patterns in the wake of this pandemic must ensure that people rather than systems prevail…

Sunscreens - Which and what for?

It is well established that sun exposure is the main cause for the development of skin cancer. Chronic continuous UV radiation is believed to induce malignant melanoma, whereas intermittent high-dose UV exposure contributes to the occurrence of actinic keratosis as precursor lesions of squamous cell carcinoma as well as basal cell carcinoma. Not only photocarcinogenesis but also the mechanisms of photoaging have recently become apparent. In this respect the use of sunscreens seemed to prove to be more and more important and popular within the last decades. However, there is still inconsistency about the usefulness of sunscreens. Several studies show that inadequate use and incomplete UV spectrum efficacy may compromise protection more than previously expected. The sunscreen market is crowded by numerous products. Inorganic sunscreens such as zinc oxide and titanium oxide have a wide spectral range of activity compared to most of the organic sunscreen products. It is not uncommon for organic sunscreens to cause photocontact allergy, but their cosmetic acceptability is still superior to the one given by inorganic sunscreens. Recently, modern galenic approaches such as micronization and encapsulation allow the development of high-quality inorganic sunscreens. The potential systemic toxicity of organic sunscreens has lately primarily been discussed controversially in public, and several studies show contradictory results. Although a matter of debate, at present the sun protection factor (SPF) is the most reliable information for the consumer as a measure of sunscreen filter efficacy. In this context additional tests have been introduced for the evaluation of not only the protective effect against erythema but also protection against UV-induced immunological and mutational effects. Recently, combinations of UV filters with agents active in DNA repair have been introduced in order to improve photoprotection. This article reviews the efficacy of sunscreens in the prevention of epithelial and nonepithelial skin cancer, the effect on immunosuppression and the value of the SPF as well as new developments on the sunscreen market. Copyright (C) 2005 S. Karger AG, Basel

Unpicking the links between research and teaching in Higher Education

ABSTRACT The Bradley Report (2008) highlights a need to investigate the experiences of international students in regard to learning and teaching with a focus on local and contextual issues. This presentation results from Participatory Action Research (Haslett, 2009) to explore learning and teaching issues relevant to international undergraduate nursing students at one campus of a Queensland University. Nursing education research is informed by many approaches, including the traditional science positivist approaches. The positivist approaches assume an ordered 'real' world of teaching, which is in stark contrast to the experience of many neophyte nurse educators. In this project, PAR exposed the differences between espoused teaching theories and best practice as promoted by the University and actual teaching beliefs and practices of staff. There were commonalities in staff perceptions that international nursing student learners have different and specific needs and international students were initially conceptualised as 'the problem'. Through PAR meetings, staff revealed different understandings of 'the problem', tensions between workload and University promotion of an internationalised curriculum. In these discussions, different teaching and learning strategies were shared. The differences between these reflected the experience of the teachers, revealing the different underlying beliefs about teaching and learning and exposing different staff values. Some staff employed a framework of equity to help contextualise the issues and their response to the challenges of teaching international student learners. Through discussions and sharing a real 'sense of the possible' was created for staff. This engagement in the process and the realisation that action was possible was a highlight of the project to date. The next step is enacting agreed upon actions. This project provides a concrete experience of PAR, which we can share and offer for further consideration