3,622 research outputs found
Control technology overview in CSI
A brief control technology overview is given in Control Structures Interaction (CSI) by illustrating that many future NASA mission present significant challenges as represented by missions having a significantly increased number of important system states which may require control and by identifying key CSI technology needs. The JPL CSI related technology developments are discussed to illustrate that some of the identified control needs are being pursued. Since experimental confirmation of the assumptions inherent in the CSI technology is critically important to establishing its readiness for space program applications, the areas of ground and flight validation require high priority
Early Stage Transformation of 2 : 1 Layer Silicates in Pyroclastic Deposits from the 1980 Eruption of Mt. St. Helens
Chemical weathering and pedogenesis are especially rapid in volcanic materials due to their glassy nature, fine particle size, and high porosity and permeability. Early stage mineralogical transformations (0-10 yr) in pyroclastic deposits from the 1980 eruptions of Mt. St. Helens were examined in a cryic-udic climatic regime of western Washington. Chemical weathering in pyroclastic flow deposits near the volcano was strongly affected by acidic precipitation (pH=3.6 to 5.2) originating from sulfuric acid emanating from the vent and by the microtopography that displayed an undulating surface with about 30 cm of relief. Weathering was more intense in depressions because they collected more water than adjacent mounds. Detrital 2 : 1 layer silicate minerals present in the original deposits of the depressions were degraded within five years to poorly crystalline kaolin and noncrystalline hydroxy-Al polymers and aluminosilicates. In the mound landscape position, there was no apparent alteration of the detrital 2 : 1 layer silicates. In forested areas receiving airfall tephra, weathering reactions were driven by carbonic acid originating from CO_2 diffusion from the buried soil. Aluminum released by weathering was preferentially retained as Al-humus complexes and hydroxy-Al interlayers of 2 : 1 layer silicates, which inhibited early formation of allophanic materials. We conclude that 2 : 1 layer silicates in pyroclastic deposits can be rapidly transformed with the resulting weathering products controlled by the dominant proton donor
Sequential release of lysosomal inflammation mediators and chemiluminescence response of stimulated polymorphonuclear leukocytes
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Assessment of Long-Term Watershed Management on Reservoir Phosphorus Concentrations and Export Fluxes.
Source water nutrient management to prevent eutrophication requires critical strategies to reduce watershed phosphorus (P) loadings. Shanxi Drinking-Water Source Area (SDWSA) in eastern China experienced severe water quality deterioration before 2010, but showed considerable improvement following application of several watershed management actions to reduce P. This paper assessed the changes in total phosphorus (TP) concentrations and fluxes at the SDWSA outlet relative to watershed anthropogenic P sources during 2005⁻2016. Overall anthropogenic P inputs decreased by 21.5% over the study period. Domestic sewage, livestock, and fertilizer accounted for (mean ± SD) 18.4 ± 0.6%, 30.1 ± 1.9%, and 51.5 ± 1.5% of total anthropogenic P inputs during 2005⁻2010, compared to 24.3 ± 2.7%, 8.8 ± 10.7%, and 66.9 ± 8.0% for the 2011⁻2016 period, respectively. Annual average TP concentrations in SDWSA decreased from 0.041 ± 0.019 mg/L in 2009 to 0.025 ± 0.013 mg/L in 2016, a total decrease of 38.2%. Annual P flux exported from SDWSA decreased from 0.46 ± 0.04 kg P/(ha·a) in 2010 to 0.25 ± 0.02 kg P/(ha·a) in 2016, a decrease of 44.9%. The success in reducing TP concentrations was mainly due to the development of domestic sewage/refuse collection/treatment and improved livestock management. These P management practices have prevented harmful algal blooms, providing for safe drinking water
What Does a Sage-Grouse Eat?
Although sage-grouse may eat only sagebrush during the winter, knowing that they need to eat other foods at other times of the year helps wildlife managers implement projects that will ensure a balanced diet. By knowing what a sage-grouse eats and when, we can determine what we need to do to maintain and improve populations and their habitats
- …