Direct imaging of RecA nucleation and growth on single molecules of SSB-coated ssDNA.

Escherichia coli RecA is the defining member of a ubiquitous class of DNA strand-exchange proteins that are essential for homologous recombination, a pathway that maintains genomic integrity by repairing broken DNA. To function, filaments of RecA must nucleate and grow on single-stranded DNA (ssDNA) in direct competition with ssDNA-binding protein (SSB), which rapidly binds and continuously sequesters ssDNA, kinetically blocking RecA assembly. This dynamic self-assembly on a DNA lattice, in competition with another protein, is unique for the RecA family compared to other filament-forming proteins such as actin and tubulin. The complexity of this process has hindered our understanding of RecA filament assembly because ensemble measurements cannot reliably distinguish between the nucleation and growth phases, despite extensive and diverse attempts. Previous single-molecule assays have measured the nucleation and growth of RecA--and its eukaryotic homologue RAD51--on naked double-stranded DNA and ssDNA; however, the template for RecA self-assembly in vivo is SSB-coated ssDNA. Using single-molecule microscopy, here we directly visualize RecA filament assembly on single molecules of SSB-coated ssDNA, simultaneously measuring nucleation and growth. We establish that a dimer of RecA is required for nucleation, followed by growth of the filament through monomer addition, consistent with the finding that nucleation, but not growth, is modulated by nucleotide and magnesium ion cofactors. Filament growth is bidirectional, albeit faster in the 5'→3' direction. Both nucleation and growth are repressed at physiological conditions, highlighting the essential role of recombination mediators in potentiating assembly in vivo. We define a two-step kinetic mechanism in which RecA nucleates on transiently exposed ssDNA during SSB sliding and/or partial dissociation (DNA unwrapping) and then the RecA filament grows. We further demonstrate that the recombination mediator protein pair, RecOR (RecO and RecR), accelerates both RecA nucleation and filament growth, and that the introduction of RecF further stimulates RecA nucleation

Structure of the hDmc1-ssDNA filament reveals the principles of its architecture

In eukaryotes, meiotic recombination is a major source of genetic diversity, but its defects in humans lead to abnormalities such as Down's, Klinefelter's and other syndromes. Human Dmc1 (hDmc1), a RecA/Rad51 homologue, is a recombinase that plays a crucial role in faithful chromosome segregation during meiosis. The initial step of homologous recombination occurs when hDmc1 forms a filament on single-stranded (ss) DNA. However the structure of this presynaptic complex filament for hDmc1 remains unknown. To compare hDmc1-ssDNA complexes to those known for the RecA/Rad51 family we have obtained electron microscopy (EM) structures of hDmc1-ssDNA nucleoprotein filaments using single particle approach. The EM maps were analysed by docking crystal structures of Dmc1, Rad51, RadA, RecA and DNA. To fully characterise hDmc1-DNA complexes we have analysed their organisation in the presence of Ca2+, Mg2+, ATP, AMP-PNP, ssDNA and dsDNA. The 3D EM structures of the hDmc1-ssDNA filaments allowed us to elucidate the principles of their internal architecture. Similar to the RecA/Rad51 family, hDmc1 forms helical filaments on ssDNA in two states: extended (active) and compressed (inactive). However, in contrast to the RecA/Rad51 family, and the recently reported structure of hDmc1-double stranded (ds) DNA nucleoprotein filaments, the extended (active) state of the hDmc1 filament formed on ssDNA has nine protomers per helical turn, instead of the conventional six, resulting in one protomer covering two nucleotides instead of three. The control reconstruction of the hDmc1-dsDNA filament revealed 6.4 protein subunits per helical turn indicating that the filament organisation varies depending on the DNA templates. Our structural analysis has also revealed that the N-terminal domain of hDmc1 accomplishes its important role in complex formation through domain swapping between adjacent protomers, thus providing a mechanistic basis for coordinated action of hDmc1 protomers during meiotic recombination

RecA and RadA Proteins of Brucella abortus Do Not Perform Overlapping Protective DNA Repair Functions following Oxidative Burst

Very little is known about the role of DNA repair networks in Brucella abortus and its role in pathogenesis. We investigated the roles of RecA protein, DNA repair, and SOS regulation in B. abortus. While recA mutants in most bacterial species are hypersensitive to UV damage, surprisingly a B. abortus recA null mutant conferred only modest sensitivity. We considered the presence of a second RecA protein to account for this modest UV sensitivity. Analyses of the Brucella spp. genomes and our molecular studies documented the presence of only one recA gene, suggesting a RecA-independent repair process. Searches of the available Brucella genomes revealed some homology between RecA and RadA, a protein implicated in E. coli DNA repair. We considered the possibility that B. abortus RadA might be compensating for the loss of RecA by promoting similar repair activities. We present functional analyses that demonstrated that B. abortus RadA complements a radA defect in E. coli but could not act in place of the B. abortus RecA. We show that RecA but not RadA was required for survival in macrophages. We also discovered that recA was expressed at high constitutive levels, due to constitutive LexA cleavage by RecA, with little induction following DNA damage. Higher basal levels of RecA and its SOS-regulated gene products might protect against DNA damage experienced following the oxidative burst within macrophages. Originally published Journal of Bacteriology, Vol. 188, No. 14, July 200

Distinct DNA repair pathways involving RecA and nonhomologous end joining in Mycobacterium smegmatis

Mycobacterium smegmatis was used to study the relationship between DNA repair processes involving RecA and nonhomologous end joining (NHEJ). The effect of gene deletions in recA and/or in two genes involved in NHEJ (ku and ligD) was tested on the ability of bacteria to join breaks in plasmids transformed into them and in their response to chemicals that damage DNA. The results provide in vivo evidence that only NHEJ is required for the repair of noncompatible DNA ends. By contrast, the response of mycobacteria to mitomycin C preferentially involved a RecA-dependent pathway

Recombinant DNA Molecules of Bacteriophage phi X174

phi X174 DNA structures containing two different parental genomes were detected genetically and examined by electron microscopy. These structures consisted of two monomeric double-stranded DNA molecules linked in a figure 8 configuration. Such DNA structures were observed to be formed preferentially in host recA+ cells or recA+ cell-free systems. Since the host recA+ allele is required for most phi X174 recombinant formation, we conclude that the observed figure 8 molecules are intermediates in, or end products of, a phi X174 recombination event. We propose that recombinant figure 8 DNA molecules arise as a result of "single-strand aggression," are stabilized by double-strand "branch migration," and represent a specific example of a common intermediate in genetic recombination

High fidelity of RecA-catalyzed recombination: a watchdog of genetic diversity

Homologous recombination plays a key role in generating genetic diversity, while maintaining protein functionality. The mechanisms by which RecA enables a single-stranded segment of DNA to recognize a homologous tract within a whole genome are poorly understood. The scale by which homology recognition takes place is of a few tens of base pairs, after which the quest for homology is over. To study the mechanism of homology recognition, RecA-promoted homologous recombination between short DNA oligomers with different degrees of heterology was studied in vitro, using fluorescence resonant energy transfer. RecA can detect single mismatches at the initial stages of recombination, and the efficiency of recombination is strongly dependent on the location and distribution of mismatches. Mismatches near the 5' end of the incoming strand have a minute effect, whereas mismatches near the 3' end hinder strand exchange dramatically. There is a characteristic DNA length above which the sensitivity to heterology decreases sharply. Experiments with competitor sequences with varying degrees of homology yield information about the process of homology search and synapse lifetime. The exquisite sensitivity to mismatches and the directionality in the exchange process support a mechanism for homology recognition that can be modeled as a kinetic proofreading cascade.Comment: http://www.weizmann.ac.il/complex/tlusty/papers/NuclAcidRes2006.pdf http://nar.oxfordjournals.org/cgi/content/short/34/18/502

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

A novel pathway producing dimethylsulphide in bacteria is widespread in soil environments

The volatile compound dimethylsulphide (DMS) is important in climate regulation, the sulphur cycle and signalling to higher organisms. Microbial catabolism of the marine osmolyte dimethylsulphoniopropionate (DMSP) is thought to be the major biological process generating DMS. Here we report the discovery and characterisation of the first gene for DMSP-independent DMS production in any bacterium. This gene, mddA, encodes a methyltransferase that methylates methanethiol (MeSH) and generates DMS. MddA functions in many taxonomically diverse bacteria including sediment-dwelling pseudomonads, nitrogen-fixing bradyrhizobia and cyanobacteria, and mycobacteria, including the pathogen Mycobacterium tuberculosis. The mddA gene is present in metagenomes from varied environments, being particularly abundant in soil environments, where it is predicted to occur in up to 76% of bacteria. This novel pathway may significantly contribute to global DMS emissions, especially in terrestrial environments, and could represent a shift from the notion that DMSP is the only significant precursor of DMS