Epidemiological characteristics of Leptospira spp. infection in bovine herds in Mato Grosso do Sul, Brazil

Foi realizado um inquérito epidemiológico da leptospirose em bovinos de rebanhos de corte do estado de Mato Grosso do Sul, de modo a determinar a frequência e as sorovariedades reagentes. Para isso, foram examinados 4.629 bovinos de corte, com uma coleção de 33 sorovariedades de Leptospira, por meio da prova de Soroaglutinação Microscópica (MAT). Dos 4.629 animais examinados, 3.814 (82,39%) foram reagentes com reações predominates para o sorogrupo Sejroe, sorovar Wolffi (36,49%). Assim, a alta frequência de animais reagentes encontrada justifica a implantação de medidas gerais e específicas para conter e/ou prevenir a infecção nos animais dessa região.The epidemiological characteristics of bovine leptospirosis in animals and herds in Mato Grosso do Sul were investigated to determine parameters such as disease frequency and the serovars reactant in beef cattle herds. A total of 4,629 beef cattle herds were examined against 33 Leptospira spp. serovars. The serum samples were submitted to the microscopic agglutination test (MAT) for the serological diagnosis of leptospirosis. The MAT results showed that 3,814 (82.39%) of the 4,629 animals evaluated were seropositive for the bacterium, with serological reactions mainly to serogroup Sejroe, serovar Wolffi (36.49%). The observed high frequency of reactive animals demonstrates the relevance of the infection. Therefore, general and specific measures should be implemented to contain and/or prevent infection of the animals in the studied region

SPATIAL ANALYSIS OF PREVALENCE OF ANTI-LEPTOSPIRA AGGLUTININS AND EPIDEMIOLOGIC RISK IN CATTLE IN THE PANTANAL OF CÁCERES-MT, BRAZIL

The seroprevalence, spatial distribution and risk analysis of anti-leptospira agglutinins in cattle were studied in the Pantanal of Mato Grosso, Cáceres, Mato Grosso State (MT), Brazil in 2005. Geo-Technologies and scan statistics to evaluate possible areas of differential risk were used. The objective of this paper is to execute a spatial analysis of anti-leptospira agglutinins prevalence and epidemiological risk in cattle in the Pantanal of Cáceres/MT. The sample size was about 2.5% of cattle by pasture area, based on a population of 79,582 animals, aged over four months. We collected 2,123 blood serum samples from the cattle of four age groups, namely: from 4 to 12 months, from 13 to 24 months, from 25 to 36 months and older than 36 months from both genders. The sera samples were tested by a microscope agglutination technique, against 17 leptospira serovars. About 15% of the male cattle and 85% of female cattle were seropositive with at least one serovar, constituting 57.93% of total of samples. All farms presented seropositive cattle and the average prevalence found in 29 farms was about 61.07%. The risk analysis showed that the infection for pathogenic leptospira at cattle does not occur randomly, showing two areas with the highest relative risk, a primary cluster with RR of 1.45 and a secondary one with RR of 1.38. The primary cluster areas are associated to strong inundation areas whereas the secondary ones to moderate inundation areas, demonstrating that the leptospira bacteria causing leptospirosis can survive longer on strongly inundated areas. Key words: Geo-Technologies. Spatial distribution. Moisture áreas. Upper Paraguay river basin. Mato Grosso State. Análise espacial da prevalência de aglutininas anti-leptospira e de risco epidemiológico em bovinos no pantanal de Cáceres-MT, Brasil A soroprevalência, distribuição espacial e análise de risco de aglutininas anti-leptospira em bovinos foi estudada no Pantanal matogrossense, no município de Cáceres-MT em 2005, utilizando geotecnologias e estatística de varredura para avaliar possíveis áreas de risco diferenciado. Este trabalho propõe realizar a análise espacial da prevalência de aglutininas anti-leptospira e de risco epidemiológico em bovinos no Pantanal de Cáceres/MT. O tamanho da amostra foi de 2,5% dos bovinos por pasto ocupado, baseado em uma população acima de quatro meses de 79.582 animais, sendo coletadas 2.123 amostras de soro sangüíneo de bovinos entre as faixas etárias de 4 a 12 meses, 13 a 24 meses, 25 a 36 meses e mais de 36 meses de ambos os sexos. Os soros foram testados pela técnica de aglutinação microscópica, frente a 17 sorovariedades de leptospiras. Cerca de 15% dos machos e 85% das fêmeas foram sororreagentes a pelo menos uma das sorovariedades, perfazendo 57,93% de todas as amostras. Todas as fazendas apresentaram bovinos sororreagentes e a prevalência média encontrada nas 29 fazendas foi de 61,07%. Na avaliação de risco, demonstrou-se que a infecção por leptospiras patogênicas para os bovinos não ocorre ao acaso, tendo duas áreas com maior risco relativo, um cluster primário com RR de 1,45 e um secundário com RR de 1,38. Sendo que as áreas de cluster primário estão associadas às áreas de inundação forte e as de cluster secundário, às áreas de inundação moderada, demonstrando que a bactéria causadora da leptospirose sobrevive mais tempo em áreas onde a inundação é mais intensa. Palavras-chave: Geotecnologias. Distribuição espacial. Pantanal Matogrossense. Mato Grosso

Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction  was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems

Ovine leptospirosis in Brazil

Leptospirosis is a zoonosis distributed worldwide, endemic mainly in humid subtropical and tropical countries, with epidemic potential. It affects a range of both wild and domestic animals, including sheep, which transport leptospires in their urine and, therefore, can infect other animals and humans who deal with them. Therefore, leptospirosis is characterized as an occupational zoonosis. In individual herds leptospirosis can cause severe economic loss due to miscarriages and outbreaks of mastitis with a significant reduction of milk production. The disease is caused by Leptospira interrogans, which was reclassified into 13 pathogenic species, and distributed into more than 260 serovars classified into 23 serogroups. The clinical signs of infection may vary depending on the serovar and host. In maintenance hosts, antibody production is generally low; there are relatively mild signs of the disease, and a prolonged carrier state with organisms in the kidneys. In incidental hosts, the disease may be more severe, with high titers of circulating antibodies and a very short or nonexistent renal carrier state. In general, young animals with renal and hepatic failure have more serious infections than adults. Several diseases may produce symptoms similar to those of leptospirosis, so that laboratory confirmation, through microscopic agglutination test, for example, is required. The effectiveness of treatment depends on early diagnosis and appropriate therapy, depending on clinical features, since leptospirosis can develop into chronic liver disease and nephropathy, progressing towards death. Improvements in habitation and sanitary conditions, rodent control, vaccination, isolation and treatment of affected animals are the main measures for the control of leptospirosis

Serological diagnosis and molecular characterization of Leptospira spp. in the blood and urine of bovine females from refrigerated slaughterhouses

Leptospirosis is an important socioeconomic disease in humans, as well as in domestic and wild animals, being caused by Leptospira spp. Bovine animals are considered reservoirs of this disease, because they intermittently disseminate the bacteria into the environment through their urine. In this way, the cattle an important source of Leptospira infection. The objective of this study was to detect Leptospira spp. antibodies and DNA in bovine females from two refrigerated slaughterhouses in the microregion of Umuarama, Paraná, Brazil. In particular, blood and urine samples from 52 crossbred bovine females older than 36 months from the two slaughterhouses were used. The microscopic agglutination test (MAT) was used to detect leptospiral antibodies, and the polymerase chain reaction (PCR) and subsequent sequencing were used to detect Leptospira DNA. The MAT yielded 22 (42.3%) serum samples considered reagent, while the nested PCR test resulted in one amplified sample (1.9%) of 289 bp. This single sample was then amplified again using primers for the SecY gene (549 bp). Sequencing of this gene characterized the bacteria as L. borgpetersenii that were similar to the serovar Hardjo of the genotype Hardjobovis. This is the first molecular confirmation of Hardjobovis-like L. borgpetersenii in the urine of crossbred bovine females older than 36 months from slaughterhouses in the microregion of Umuarama. This study’s results show that it is important to combine serological and molecular diagnosis in the detection of Leptospira spp. Therefore, both methods were used to improve our understanding of the epidemiology of this disease in bovine animals from the microregion of Umuarama. In addition, the analysis informed the subsequent adoption of preventive measures and educational One Health actions to prevent economic losses related to the herd, as well as social losses related to workers and the environment

Avaliação da soroprevalência e fatores de risco para leptospirose em rebanhos bovinos leiteiros de diferentes mesorregiões do Rio Grande do Sul.

Dissertação (Mestrado em Ciências) - Programa de Pós Graduação em Veterinária, Faculdade de Veterinária, Universidade Federal de Pelotas, Pelotas, 2019. Orientador: Odir Antônio Dellagostin; Coorientadora: Lígia Margareth Cantarelli Pegoraro

Zoonoses in humans from small rural properties in Jataizinho, Parana, Brazil.

publishersversionpublishe

Diagnosis of Bovine Genital Campylobacteriosis in South America

Bovine genital campylobacteriosis (BGC) is a venereal infectious disease that affects reproduction. It is caused by the Gram-negative bacillus Campylobacter fetus subspecies venerealis (Cfv), which may include the biotype intermedius. The bull is a lifelong asymptomatic carrier and transmitter of the disease. In females Cfv may cause infertility and sporadic abortion. The objective of this study is to review and discuss methods for the diagnosis of BGC, its prevalence and economic impact in South America. BGC is a worldwide distributed disease and can cause a pregnancy rate decrease of 15–25%. The farm prevalence of BGC in different regions of South American countries shows a variation between 2.3 and 100%. Discrepancies may depend on the differences on sanitary, management, and reproductive practices between farms and regions, but also on the interpretation of different diagnostic tests. Currently known laboratory tests include bacterial culture, direct immunofluorescence, immunoenzymatic assays, vaginal mucus agglutination test, PCR-based methods, histology and immunohistochemistry, which are applied and interpreted in diagnostic laboratories at different scales. Epidemiologic data of BGC in South America should be interpreted with caution. High prevalence has been reported in some studies, although the low specificity of the diagnostic tests used could lead to an overestimation of the results