Direct imaging of RecA nucleation and growth on single molecules of SSB-coated ssDNA.

Escherichia coli RecA is the defining member of a ubiquitous class of DNA strand-exchange proteins that are essential for homologous recombination, a pathway that maintains genomic integrity by repairing broken DNA. To function, filaments of RecA must nucleate and grow on single-stranded DNA (ssDNA) in direct competition with ssDNA-binding protein (SSB), which rapidly binds and continuously sequesters ssDNA, kinetically blocking RecA assembly. This dynamic self-assembly on a DNA lattice, in competition with another protein, is unique for the RecA family compared to other filament-forming proteins such as actin and tubulin. The complexity of this process has hindered our understanding of RecA filament assembly because ensemble measurements cannot reliably distinguish between the nucleation and growth phases, despite extensive and diverse attempts. Previous single-molecule assays have measured the nucleation and growth of RecA--and its eukaryotic homologue RAD51--on naked double-stranded DNA and ssDNA; however, the template for RecA self-assembly in vivo is SSB-coated ssDNA. Using single-molecule microscopy, here we directly visualize RecA filament assembly on single molecules of SSB-coated ssDNA, simultaneously measuring nucleation and growth. We establish that a dimer of RecA is required for nucleation, followed by growth of the filament through monomer addition, consistent with the finding that nucleation, but not growth, is modulated by nucleotide and magnesium ion cofactors. Filament growth is bidirectional, albeit faster in the 5'→3' direction. Both nucleation and growth are repressed at physiological conditions, highlighting the essential role of recombination mediators in potentiating assembly in vivo. We define a two-step kinetic mechanism in which RecA nucleates on transiently exposed ssDNA during SSB sliding and/or partial dissociation (DNA unwrapping) and then the RecA filament grows. We further demonstrate that the recombination mediator protein pair, RecOR (RecO and RecR), accelerates both RecA nucleation and filament growth, and that the introduction of RecF further stimulates RecA nucleation

Rmi1 stimulates decatenation of double Holliday junctions during dissolution by Sgs1-Top3

double Holliday junction (dHJ) is a central intermediate of homologous recombination that can be processed to yield crossover or non-crossover recombination products. To preserve genomic integrity, cells possess mechanisms to avoid crossing over. We show that Saccharomyces cerevisiae Sgs1 and Top3 proteins are sufficient to migrate and disentangle a dHJ to produce exclusively non-crossover recombination products, in a reaction termed "dissolution." We show that Rmi1 stimulates dHJ dissolution at low Sgs1-Top3 protein concentrations, although it has no effect on the initial rate of Holliday junction (HJ) migration. Rmi1 serves to stimulate DNA decatenation, removing the last linkages between the repaired and template DNA molecules. Dissolution of a dHJ is a highly efficient and concerted alternative to nucleolytic resolution that prevents crossing over of chromosomes during recombinational DNA repair in mitotic cells and thereby contributes to genomic integrity

Improved methods for creating migratable Holliday junction substrates

Previously, we published a method for creating a novel DNA substrate, the double Holliday junction substrate. This substrate contains two Holliday junctions that are mobile, topologically constrained and separated by a distance comparable with conversion tract lengths. Although useful for studying late stage homologous recombination in vitro, construction of the substrate requires significant effort. In particular, there are three bottlenecks: (i) production of large quantities of single-stranded DNA; (ii) the loss of a significant portion of the DNA following the recombination step; and (iii) the loss of DNA owing to inefficient gel extraction. To address these limitations, we have made the following changes to the protocol: (i) use of a helper plasmid, rather than exogenous helper phage, to produce single-stranded DNA; (ii) use of the unidirectional ϕC31 integrase system in place of the bidirectional Cre recombinase reaction; and (iii) gel extraction by DNA diffusion. Here, we describe the changes made to the materials and methods and characterize the substrates that can be produced, including migratable single Holliday junctions, hemicatenanes and a quadruple Holliday junction substrate

Direct imaging of RecA nucleation and growth on single molecules of SSB-coated ssDNA.

Escherichia coli RecA is the defining member of a ubiquitous class of DNA strand-exchange proteins that are essential for homologous recombination, a pathway that maintains genomic integrity by repairing broken DNA. To function, filaments of RecA must nucleate and grow on single-stranded DNA (ssDNA) in direct competition with ssDNA-binding protein (SSB), which rapidly binds and continuously sequesters ssDNA, kinetically blocking RecA assembly. This dynamic self-assembly on a DNA lattice, in competition with another protein, is unique for the RecA family compared to other filament-forming proteins such as actin and tubulin. The complexity of this process has hindered our understanding of RecA filament assembly because ensemble measurements cannot reliably distinguish between the nucleation and growth phases, despite extensive and diverse attempts. Previous single-molecule assays have measured the nucleation and growth of RecA--and its eukaryotic homologue RAD51--on naked double-stranded DNA and ssDNA; however, the template for RecA self-assembly in vivo is SSB-coated ssDNA. Using single-molecule microscopy, here we directly visualize RecA filament assembly on single molecules of SSB-coated ssDNA, simultaneously measuring nucleation and growth. We establish that a dimer of RecA is required for nucleation, followed by growth of the filament through monomer addition, consistent with the finding that nucleation, but not growth, is modulated by nucleotide and magnesium ion cofactors. Filament growth is bidirectional, albeit faster in the 5'→3' direction. Both nucleation and growth are repressed at physiological conditions, highlighting the essential role of recombination mediators in potentiating assembly in vivo. We define a two-step kinetic mechanism in which RecA nucleates on transiently exposed ssDNA during SSB sliding and/or partial dissociation (DNA unwrapping) and then the RecA filament grows. We further demonstrate that the recombination mediator protein pair, RecOR (RecO and RecR), accelerates both RecA nucleation and filament growth, and that the introduction of RecF further stimulates RecA nucleation

Rmi1 stimulates decatenation of double Holliday junctions during dissolution by Sgs1-Top3.

A double Holliday junction (dHJ) is a central intermediate of homologous recombination that can be processed to yield crossover or non-crossover recombination products. To preserve genomic integrity, cells possess mechanisms to avoid crossing over. We show that Saccharomyces cerevisiae Sgs1 and Top3 proteins are sufficient to migrate and disentangle a dHJ to produce exclusively non-crossover recombination products, in a reaction termed "dissolution." We show that Rmi1 stimulates dHJ dissolution at low Sgs1-Top3 protein concentrations, although it has no effect on the initial rate of Holliday junction (HJ) migration. Rmi1 serves to stimulate DNA decatenation, removing the last linkages between the repaired and template DNA molecules. Dissolution of a dHJ is a highly efficient and concerted alternative to nucleolytic resolution that prevents crossing over of chromosomes during recombinational DNA repair in mitotic cells and thereby contributes to genomic integrity

Top3α is required during the convergent migration step of double Holliday junction dissolution.

Although Blm and Top3α are known to form a minimal dissolvasome that can uniquely undo a double Holliday junction structure, the details of the mechanism remain unknown. It was originally suggested that Blm acts first to create a hemicatenane structure from branch migration of the junctions, followed by Top3α performing strand passage to decatenate the interlocking single strands. Recent evidence suggests that Top3α may also be important for assisting in the migration of the junctions. Using a mismatch-dHJ substrate (MM-DHJS) and eukaryotic Top1 (in place of Top3α), we show that the presence of a topoisomerase is required for Blm to substantially migrate a topologically constrained Holliday junction. When investigated by electron microscopy, these migrated structures did not resemble a hemicatenane. However, when Blm is together with Top3α, the dissolution reaction is processive with no pausing at a partially migrated structure. Potential mechanisms are discussed

Rmi1 stimulates decatenation of double Holliday junctions during dissolution by

Expression and purification of Top3. The TOP3 gene was amplified by polymerase chain reaction (PCR) using wild type S. cerevisiae genomic DNA as a template (strain S288C, Research Genetics) and primer pairs PC3 (CTCTGAACTCGAGCTGGAAGTTCTGTTCCAGGGGCCCGCTAGCGGATCCATG AAAGTGCTATGTGTCGCAG; NheI site underlined and the sequence complementary to TOP3 in bold) and PC4 (CGCAAATCCTCGAGCCCGGGTTACATGGATGCCTTGACACGG; XhoI site underlined and the sequence complementary to TOP3 in bold). The reaction products were digested with NheI and XhoI restriction endonucleases, and cloned into NheI and XhoI sites in modified pFastBac1 vector 1, creating pFB-GST-Top3. This placed the TOP3 coding sequence downstream from sequence encoding glutathione-S-transferase (GST) and a PreScission protease cleavage site, all of which is under the control of the baculovirus polyhedron promoter. Proteins were expressed using the Bac-to-Bac expression system (Invitrogen) in Sf9 cells according to manufacturer’s recommendations. All purification steps were carried out on ice or at 4°C

BRCA2 chaperones RAD51 to single molecules of RPA-coated ssDNA

Mutations in the breast cancer susceptibility gene, BRCA2, greatly increase an individual's lifetime risk of developing breast and ovarian cancers. BRCA2 suppresses tumor formation by potentiating DNA repair via homologous recombination. Central to recombination is the assembly of a RAD51 nucleoprotein filament, which forms on single-stranded DNA (ssDNA) generated at or near the site of chromosomal damage. However, replication protein-A (RPA) rapidly binds to and continuously sequesters this ssDNA, imposing a kinetic barrier to RAD51 filament assembly that suppresses unregulated recombination. Recombination mediator proteins-of which BRCA2 is the defining member in humans-alleviate this kinetic barrier to catalyze RAD51 filament formation. We combined microfluidics, microscopy, and micromanipulation to directly measure both the binding of full-length BRCA2 to-and the assembly of RAD51 filaments on-a region of RPA-coated ssDNA within individual DNA molecules designed to mimic a resected DNA lesion common in replication-coupled recombinational repair. We demonstrate that a dimer of RAD51 is minimally required for spontaneous nucleation; however, growth self-terminates below the diffraction limit. BRCA2 accelerates nucleation of RAD51 to a rate that approaches the rapid association of RAD51 to naked ssDNA, thereby overcoming the kinetic block imposed by RPA. Furthermore, BRCA2 eliminates the need for the rate-limiting nucleation of RAD51 by chaperoning a short preassembled RAD51 filament onto the ssDNA complexed with RPA. Therefore, BRCA2 regulates recombination by initiating RAD51 filament formation

Improved methods for creating migratable Holliday junction substrates

Previously, we published a method for creating a novel DNA substrate, the double Holliday junction substrate. This substrate contains two Holliday junctions that are mobile, topologically constrained and separated by a distance comparable with conversion tract lengths. Although useful for studying late stage homologous recombination in vitro, construction of the substrate requires significant effort. In particular, there are three bottlenecks: (i) production of large quantities of single-stranded DNA; (ii) the loss of a significant portion of the DNA following the recombination step; and (iii) the loss of DNA owing to inefficient gel extraction. To address these limitations, we have made the following changes to the protocol: (i) use of a helper plasmid, rather than exogenous helper phage, to produce single-stranded DNA; (ii) use of the unidirectional ϕC31 integrase system in place of the bidirectional Cre recombinase reaction; and (iii) gel extraction by DNA diffusion. Here, we describe the changes made to the materials and methods and characterize the substrates that can be produced, including migratable single Holliday junctions, hemicatenanes and a quadruple Holliday junction substrate