Exponential speed of mixing for skew-products with singularities

Let $f: [0,1]\times [0,1] \setminus {1/2} \to [0,1]\times [0,1]$ be the $C^\infty$ endomorphism given by $$f(x,y)=(2x- [2x], y+ c/|x-1/2|- [y+ c/|x-1/2|]),$$ where $c$ is a positive real number. We prove that $f$ is topologically mixing and if $c>1/4$ then $f$ is mixing with respect to Lebesgue measure. Furthermore we prove that the speed of mixing is exponential.Comment: 23 pages, 3 figure

Cytocompatibility of Caffeic Acid-Silica Hybrid Materials on NIH-3T3 Fibroblast Cells

The hydroxycinnamoyl compound caffeic acid (CA), broadly occurring in plants, is receiving special attention in materials science thanks to its antioxidant, anti-inflammatory, and antimicrobial activities that make it promising for application use in various sectors. In this context, CA–based peptide biomaterials are recently developed as eco-friendly and multifunctional free radical scavengers useable in a wide range of consumer manufacture, ranging from cosmetics to household products, as well as clinical applications, including imaging, drug delivery, and disinfection. Furthermore, a water-soluble chitosan-caffeic acid conjugate, effective in delaying lipid oxidation, is also synthetized. Herein, exploiting sol-gel route versatility, CA/silica materials are synthetized. Hybrids, chemically characterized mainly through spectroscopic techniques, varied in their relative CA content, which represented 5%, 10%, 15%, or 20% of materials’ weight. The synthetized materials are able to elicit anti-radical properties. The CA amount appeared to be determinant in anti-radical activity, as well as in biocompatibility assessment. To this latter purpose, mouse embryonic fibroblast cell line NIH-3T3 cells are utilized and directly exposed to hybrid materials. Redox mitochondrial activity is evaluated by means of the MTT test, whose results are in accordance with the materials’ biocompatibility

First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

In vitro efficacy of alphacypermethrin on the buffalo louse Haematopinus tuberculatus (Burmeister, 1839).

In Italy buffalo farms adopted intensive breeding techniques, however the high density of animals in intensive breeding favours the diffusion of ectoparasites, such as louse. The aim of this study was to determine the in vitro efficacy of the insecticide alphacypermethrin (ACYP) against the buffalo louse, Haematopinus tuberculatus. The study was performed by using louse collected from animals in a commercial buffalo farm located in the Campania region of Southern Italy. Lice (adults and nymphs) were collected from highly infested buffaloes. The ACYP was diluted with physiological solution to different concentrations: 1.5%, 0.75%, 0.37%. A volume of 600 μl of the diluted sample was spread evenly over a filter paper held in the lower half of Petri dish. Ten adult lice and ten nymphs were placed on the top of each filter paper disc. The control groups were treated with physiological solution. Seven replicates were used for each concentration. The louse vitality was assessed at different time intervals: 1, 2, 4, 8, 10, 15, 20, 30, 40, 50, 60 minutes, after every 10 min until 240 min or at the louse death. After 240 min the louse vitality was examined each 60 min until 540 min. In vitro bioassays revealed that the lousicidal efficacy of ACYP improved as the concentration and the exposure time increased. The results of this in vitro study confirm that ACYP at 1.5% concentration can also be used in buffalo for the control of lice, as already in use in cattle. Further field trials will need to be conducted to confirm the safety, the dosage and the in vivo parasitological efficacy of this drug on buffaloes

Tetracyclines in COVID-19 patients quarantined at home: Literature evidence supporting real-world data from a multicenter observational study targeting inflammatory and infectious dermatoses

Tetracyclines (TetraC) are widely used in dermatology for both inflammatory and infectious dermatoses; recently both in vivo and in vitro studies started to suggest also a potential antiviral effect. During COVID-19 outbreak, several dermatological patients contracted SARS-CoV-2 experiencing only mild symptoms, but no protocol were approved. A multicenter prospective observational study that enrolled COVID-19 patients visited with teledermatology and undergoing TetraC was performed. About 38 adult outpatients (M/F: 20/18, age 42.6 years [21-67]) were enrolled. During the TetraC treatment, symptoms resolved in all patients within 10 days. Remarkably, ageusia and anosmia disappeared in the first week of TetraC treatment. TetraC seem a promising drug to treat COVID-19 outpatients with mild symptoms

New oxaliplatin-pyrophosphato analogs with improved in vitro cytotoxicity

Two new Pt(II)-pyrophosphato complexes containing the carrier ligands cis-1,3- diaminocyclohexane (cis-1,3-DACH) and trans-1,2-diamine-4-cyclohexene (1,2-DACHEX), variants of the 1R,2R-diaminocyclohexane ligand present in the clinically used Pt-drug oxaliplatin, have been synthesized with the aim of developing new potential antitumor drugs with high bone tropism. The complexes are more stable at physiological pH than in acid conditions, with Na2[Pt(pyrophosphato)(cis-1,3-DACH)] (1) slightly more stable than Pt(dihydrogenpyrophosphato)(1,2-DACHEX)] (2). The greater reactivity at acidic pH ensures a greater efficacy at the tumor site. Preliminary NMR studies indicate that 1 and 2 react slowly with 5’-GMP (used as a model of nucleic acids), releasing the pyrophosphate ligand and affording the bis 5’-GMP adduct. In vitro cytotoxicity assays performed against a panel of four human cancer cell lines have shown that both compounds are more active than oxaliplatin. Flow cytometry studies on HCT116 cells showed that the pyrophosphato compounds with the non-classical 1,3- and 1,4- diaminocyclohexane ligands (1 and 4) are the most capable to induce cells’ death by apoptosis and necrosis

First description of Eucoleus garfiai (Gallego and Mas-Coma, 1975) in wild boar (Sus scrofa) in Italy

Eucoleus garfiai (syn. Capillaria garfiai) is a nematode infecting lingual tissue of domestic and wild swine. Prevalence data for this parasite are scant and often related to accidental findings, occurring only in Japan and a few European countries. In this study, an epidemiological survey was performed in order to identify E. garfiai in wild boar from the Campania region, southern Italy. A total of 153 wild boar carcasses were inspected over the course of two hunting seasons (2019–2020). Histological examinations were performed on tongue samples fixed and stained with haematoxylin and eosin. The scraping of dorsal tongue tissue was carried out to collect adult worms for parasitological examination. Out of 153 wild boars, 40 (26.1%, 95% CI: 19.8–33.6%) tested positive for helminths and/or eggs in tongue tissues. Parasites were identified morphologically and identification was confirmed by molecular analysis of the 18S rRNA gene, showing a 99% nucleotide match with E. garfiai sequences available in literature. No statistically significant differences were found according to age, sex nor hunting province. Our findings agree with previous histopathological data confirming the low pathogenic impact of this nematode. The present study represents the first report of E. garfiai in wild boar from Italy

The Wikiplantbase project: the role of amateur botanists in building up large online floristic databases

The Wikiplantbase project, started in 2013, provides a framework where the full set of georeferenced floristic records of Tuscany and Sardinia can be entered, stored, updated and freely accessed through the Internet. Mainly thanks to the collaboration of amateur botanists, data have accumulated quickly. All records entered by collaborators are submitted to the project coordinators, who are enabled to accept, modify, or reject them. As of 22 November 2016, Wikiplantbase #Toscana holds 116,402 verified floristic records (90% based on published literature, 5% on unpublished herbarium specimens, 5% on field observations), and Wikiplantbase #Sardegna 40,043 (77% published literature, 18% unpublished herbarium specimens, 5% on field observations ). The records include over 90% of the specific and subspecific taxa known for Tuscany and about 70% – but rapidly growing – of those known for Sardinia. The most recorded species are Quercus ilex L. (Fagaceae) for Tuscany and Pistacia lentiscus L. (Anacardiaceae) for Sardinia. With minor software tweaking, the online platform Wikiplantbase might be adopted in other contexts, resulting in a well connected network of regional floristic databases suited to exploit the involvement – still largely untapped – of nonacademic collaborators, as advocated by citizen science

3D GRID-based pharmacophore and Metadynamics approaches for the rational design of N-Methyl β-sheet breaker peptides as inhibitors of the Alzheimer's Aβ-amyloid fibrillogenesis

Alzheimer’s disease (AD) is a neurodegenerative disorder characterized by the loss of the cognitive functions and dementia. Several scientific evidences report that a central role in the pathogenesis of AD is played by the brain deposition of insoluble aggregates of β-amyloid protein (Aβ) proteins, thus causing neuronal cell death [1]. For this reason, one of the promising approach is to inhibit the aggregation of Aβ peptides. Because Aβ is self-assembling, one possible strategy to prevent this process is to use short peptide fragments homologous to the full-length wild-type Aβ protein. From this consideration, several short synthetic peptides were designed as beta-sheet breakers (BSB) [2]. In particular, the pentapetide Ac-LPFFD-NH2 (iAβ5p) exhibited a certain capability to inhibit Aβ fibrillogenesis [3]. iAβ5p analogs [4] were, then, designed by introducing N-Methylation at the amide bond nitrogen were also promising BSB. Here, we describe the methodological approach, which combines 3D GRID-based pharmacophore peptide screening with Well-Tempered Metadynamics simulations aimed to the discovery of novel N-Methylated BSB. This approach led us to identify two promising, cell permeable, N-Methylated peptides that were further evaluated for their BSB properties showing a significant improvement of the fibrillogenesis inhibition with respect to the lead iAβ5p

Gut microbiota and nutrient interactions with skin in psoriasis : a comprehensive review of animal and human studies

The intestinal tract (i.e., the gut), is where the body's nutrients are absorbed, and is simultaneously inhabited by numerous microbes. An increasing body of literature suggests a crucial role for the gut microbiome in modulating systemic inflammatory disease. Psoriasis is a chronic systemic inflammatory disease and its pathogenesis is related to the interaction between genetic susceptibility, immune response and environmental triggers. The omics era has allowed physicians to assess different aspects of psoriasis pathogenesis such as the microbiome, infectome, and autoinfectome. Furthermore, diet appears to play an important role in modulating disease activity, perhaps by influencing gut microbes. Given these observations, we aimed to summarize the current knowledge regarding skin-microbiome-gut-nutrients and psoriasis