33 research outputs found
First detection of tomato leaf curl New Delhi virus in melon and zucchini squash in southern Italy
In September 2017, severe symptoms and heavy infestations
of aleyrodids were reported on cucurbit crops grown in open
fields at the border between Apulia and Basilicata regions
(southern Italy). In zucchini squash symptoms consisted in
severe curling and brittle fracture of the leaves. Melon plants
showed bright yellow mosaic on leaves and necrotic streaks
along the stems, flower stalks and fruits whereas squash plants
displayed severe yellow mosaic and leaf blade deformation.
Disease incidence in the three crops was close to 100%.
Symptoms resembled those described recently for infections
of tomato leaf curl New Delhi virus (ToLCNDV) (Panno
et al., 2016) and watermelon mosaic virus (WMV) (Finetti-
Sialer et al., 2012). DNA and RNA preparations from two
plants for each species were tested by PCR, respectively, with
primers For-5âCCCTTGTAAAGTGCAGTCCT3â and Rev-
5âGGATTTGATGCGTGAGTACA3â for the AV1 gene of
ToLCNDV DNA-A and with primers For-5âAAACTGGG
CAGGGTAGCA3â and Rev-5âTAACCTGCTGTTAA
YCCCGCG3â for the WMV coat protein gene. Samples of
melon and zucchini proved positive for ToLCNDV whereas
WMV was detected in squash. No amplification products
were obtained with primers for squash leaf curl virus,
watermelon chlorotic spot virus, cucumber mosaic virus, cucumber
vein yellowing virus and zucchini yellow mosaic virus.
Amplicon identities were confirmed by sequencing.
Those from zucchini and melon showed 100% identity with
ToLCNDV from Spain (KF749224) and Sicily (KU145141)
whereas those from squash were 99% and 94% identical to
WMV from Belgium (KP980663) and Italy (FJ8231229), respectively.
The sequence of a 507 bp fragment of ToLCNDV
was deposited in GenBank under the accession number
MG269826. This is the first report of ToLCNDV in melon
and in the continental part of the Country
Integrative diagnosis, biological observations, and histopathology of the fig cyst nematode Heterodera fici Kirjanova (1954) associated with Ficus carica L. in southern Italy
Morpho-biological notes and histopathology, based on LM and SEM observations, of the fig cyst nematode Heterodera fici isolated from Ficus carica roots, collected in home and public gardens of Apulia region, southern Italy, are described and illustrated. Seventy-five localities throughout the Apulia region were sampled and one-quarter of the sampled localities had fig roots infested with H. fici, with population densities ranging from 44 to 180 cysts/100 ml of soil. All attempts to detect H. fici on ornamental Ficus spp. as well as on imported bonsai in Italy were unsuccessful. Morphometric characters of the Italian population conform to those of the type and re-description populations reported for H. fici. Molecular analysis using ITS, D2âD3 expansion domains of the 28S rRNA, and the partial 18S rRNA sequences of H. fici newly obtained in this study matched well with the corresponding sequences of H. fici present in the GenBank database. Phylogenetic trees confirmed and supported the grouping of H. fici in the Humuli group. Heterodera fici completes its embryogenic development in 14â16 days at 25 °C. Post-invasion development and maturity in the roots of F. carica seedlings is completed in 64â68 days at 25â28 °C with juveniles and adults showing different parasitic habits, being endoparasitic and semi-endoparasitic respectively. The establishment of permanent feeding sites that consist of the formation of large syncytia causes anatomical modification of vascular elements and general disorder in the root stelar structures. Syncytia structures associated with mature females showed different degrees of vacuolisation, numbers of syncytial cells, and contained nuclei and nucleoli which were constantly hypertrophied
Interlaboratory performance of a Real-Time PCR method for detection of Ceratocystis platani, the agent of canker stain of Platanus spp
Ceratocystis platani (CP), an ascomycetous fungus, is the agent of canker stain, a lethal vascular disease of Platanus species. Ceratocystis platani has been listed as a quarantine pest (EPPO A2 list) due to extensive damage caused in Southern Europe and the Mediterranean region. As traditional diagnostic assays are ineffective, a Real-Time PCR detection method based on EvaGreen, SYBR Green, and Taqman assays was previously developed, validated in-house, and included in the official EPPO standard PM7/14 (2). Here, we describe the results of a test performance study performed by nine European laboratories for the purpose of an interlaboratory validation. Verification of the DNA extracted from biological samples guaranteed the high quality of preparations, and the stability and the homogeneity of the aliquots intended for the laboratories. All of the laboratories reproduced nearly identical standard curves with efficiencies close to 100%. Testing of blind-coded DNA extracted from wood samples revealed that all performance parameters-diagnostic sensitivity, diagnostic specificity, accuracy and reproducibility-were best fit in most cases both at the laboratory and at the assay level. The previously established limit of detection, 3 fg per PCR reaction, was also validated with similar excellent results. The high interlaboratory performance of this Real-Time PCR method confirms its value as a primary tool to safeguard C. platani-free countries by way of an accurate monitoring, and to investigate the resistance level of potentially canker stain-resistant Platanus genotypes
Integrative diagnosis and parasitic habits of Cryphodera brinkmani a non-cyst forming heteroderid nematode intercepted on Japanese white pine bonsai trees imported into Italy
The non-cyst forming heteroderid nematode Cryphodera brinkmani was detected in Italy parasitizing roots of Japanese white pine bonsai (Pinus parviflora) trees imported from Japan. Morphology and morphometrical traits of the intercepted population on this new host for C. brinkmani were in agreement with the original description, except for some minor differences on male morphology. Integrative molecular data for this species were obtained using D2-D3 expansion regions of 28S rDNA, ITS1-rDNA, the partial 18S rDNA, and the protein-coding mitochondrial gene, cytochrome oxidase c subunit I (COI). The phylogenetic relationships of this species with other representatives of non-cyst and cyst-forming Heteroderidae using ITS1 are presented and indicated that C. brinkmani clustered together with other Cryphodera spp. and with Meloidodera alni suggesting a monophyletic origin of non-cyst forming nematodes (Heteroderinae sensu Luc et al. 1978), which have been considered close to the ancestor of most species of Heteroderidae. Histological observations of P. parviflora feeder roots infected by C. brinkmani indicated that nematode females induce similar anatomical alterations to those reported for C. kalesari, consisting of formation of a single uninucleate giant cell (nurse cell) with hypertrophied nucleus, prominenet nucleolus, thickened cell wall and expanding into the stele and in contact of xylem, vacuum cambium and phloem. These findings are in agreement with the results of the phylogenetic analysis and indicate a close relationship in the plant responses induced by Cryphodera nematode females with those caused by the genetically related Meloidodera spp., which also induce formation of a uninucletate giant cell.The present work was supported with funds provided by the Italian Ministry of Economy and Finance to the National Research Council for the project âInnovazione e Svi-luppo del Mezzogiorno-Conoscenze Integrate per SostenibilitĂ ed Innovazione del Made in Italy Agroalimentare-Legge n.191/2009.Peer Reviewe
Gravi infezioni di Tomato infectious chlorosis virus su pomodoro in Puglia
In 2015, 15 to 20% of tomato plants grown in a greehouse southeast of Bari (Apulia, southern Italy) showed symptoms similar to nutrient disorders or phytotoxicity. Mature leaves displayed interveinal yellowing with some dark-red areas, thickening of the leaf lamina and brittle fracture, while the new growth at the plant apex appears normal. Fruits were normal although ripening was delayed. A Tomato infectious chlorosis virus infection was detected in symptomatic samples by means of molecular hybridization with a Digoxigenin-labelled DNA probe. No other viruses
common in Italian tomato crops were detected. Thus the etiology of the disorder could be very likely attributed to TICV. This is the second report of TICV infection in protected tomato crops in Apulia but in the previous case TICV was in mixed infection with a Sw5 resistance-breaking strain of Tomato spotted wilt virus. Basic information on the ecoepidemiology of TICV is provided
PLATO: A Predictive Drug Discovery Web Platform for Efficient Target Fishing and Bioactivity Profiling of Small Molecules
PLATO (Polypharmacology pLATform predictiOn) is an easy-to-use drug discovery web platform, which has been designed with a two-fold objective: to fish putative protein drug targets and to compute bioactivity values of small molecules. Predictions are based on the similarity principle, through a reverse ligand-based screening, based on a collection of 632,119 compounds known to be experimentally active on 6004 protein targets. An efficient backend implementation allows to speed-up the process that returns results for query in less than 20 s. The graphical user interface is intuitive to give practitioners easy input and transparent output, which is available as a standard report in portable document format. PLATO has been validated on thousands of external data, with performances better than those of other parallel approaches. PLATO is available free of charge (http://plato.uniba.it/ accessed on 13 April 2022)
Anatomical changes induced by two soil-borne pathogens (Plasmodiophora brassicae and Meloidogyne javanica) in cabbage
Stunted growth of large patches of cabbage cv. Lupini, associated with severe soil infestations by the root-knot nema-
tode
Meloidogyne javanica
and the protist
Plasmodiophora brassicae
, the casual agent of clubroot disease, was observed in several
fields at Castellaneta, province of Taranto, in southern Italy. The host-parasite responses of cabbage roots to parasitism by t
he two
soil-borne pathogens was studied and compared. In roots infected by
P. brassicae
, the plasmodia were present in cortex and peri-
cycle cells, causing hypertrophy and hyperplasia, and developed into resting spores within host tissues. Parasitism of
M. javanica
was characterized by the establishment of distinct permanent feeding sites with giant cells in the cortex, endodermis and vascu
lar
parenchyma, which limit water and nutrient translocation.Peer Reviewe
De Novo Drug Design of Targeted Chemical Libraries Based on Artificial Intelligence and Pair-Based Multiobjective Optimization
Artificial intelligence and multiobjective optimization represent promising solutions to bridge chemical and biological landscapes by addressing the automated de novo design of compounds as a result of a humanlike creative process. In the present study, we conceived a novel pair-based multiobjective approach implemented in an adapted SMILES generative algorithm based on recurrent neural networks for the automated de novo design of new molecules whose overall features are optimized by finding the best trade-offs among relevant physicochemical properties (MW, logP, HBA, HBD) and additional similarity-based constraints biasing specific biological targets. In this respect, we carried out the de novo design of chemical libraries targeting neuraminidase, acetylcholinesterase, and the main protease of severe acute respiratory syndrome coronavirus 2. Several quality metrics were employed to assess drug-likeness, chemical feasibility, diversity content, and validity. Molecular docking was finally carried out to better evaluate the scoring and posing of the de novo generated molecules with respect to X-ray cognate ligands of the corresponding molecular counterparts. Our results indicate that artificial intelligence and multiobjective optimization allow us to capture the latent links joining chemical and biological aspects, thus providing easy-to-use options for customizable design strategies, which are especially effective for both lead generation and lead optimization. The algorithm is freely downloadable at https://github.com/alberdom88/moo-denovo and all of the data are available as Supporting Information
Gravi epifizie di ceppi Sw-5 resistance-breaking di Tomato spotted wilt virus su pomodoro in Puglia.
In 2015, canning tomato plants grown in open fields in the Province of Foggia (Apulia, southern Italy) showed
severe symptoms of necrosis on stems and fruits making them unmarketable already by the end of June-mid of July. Disease incidence ranged between 80 and 100% of plants. Infection of a Sw-5 resistance-breaking strain of Tomato spotted wilt virus (TSWV-RB) was detected consistently in all symptomatic samples collected from different fields by means of molecular hybridization with a Digoxigeninlabelled DNA probe. No other viruses common in Italian tomato crops were detected. Virus was characterized as Sw-5 resistance-breaking on the basis of MaeI restriction pattern of RT-PCR amplicons obtained from NSM gene and mechanical inoculation onto the Messapico and Faino tomato varieties that are resistant to the common strains of TSWV. In a field fruits of some plants showed chocolate spotlike symptom but also in this case only TSWV was detected. Thus the etiology of the epiphytotic could be attributed to a Sw-5 resistance-breaking of TSWV. Basic information on the eco-epidemiology of TSWV is provided together with possibilities of control by prevention
Redescription and molecular characterisation of Xiphinema barense Lamberti et al., 1986 (Nematoda: Longidoridae) from wild olive trees in southern Italy
A population of Xiphinema barense from wild olive trees in Torre Pozzella, Brindisi province, southern Italy, is described using both morphological and molecular studies and compared with the description of the type specimens. The wild olive nematode population agrees very well with all morphometrics provided in the original description. However, detailed observations of the lumen of the tubular portion of the uterus in paratypes and specimens of the new population revealed a clear pseudo-Z-organ with small granules mixed with crystalloid bodies which were previously undetected. Photomicrographs of adult paratypes, which were lacking in the original description, and of specimens of the new population from wild olive trees are provided. The results of the phylogenetic analyses based on the sequences of the D2-D3 expansion regions of the 28S rRNA gene and ITS rRNA genes confirm the species differentiation and indicate the phylogenetic position of X. barense and its relationship with closely related species.The present research was partially funded by the grant
219262 ArimNET_ERANET FP7 2012-2015 Project
PESTOLIVE âContribution of olive history for the management
of soilborne parasites in the Mediterranean
basinâ; and grant AGR-136 from âConsejerĂa de EconomĂa,
InnvovaciĂłn y Cienciaâ from Junta de AndalucĂa,
and Union Europea, Fondo Europeo de Desarrollo regional,
âUna manera de hacer Europaâ.Peer Reviewe