Memory, attention and fluency deficits in COPD may be a specific form of cognitive impairment

There is increasing evidence demonstrating an association between chronic obstructive pulmonary disease (COPD) and cognitive impairment. We present a narrative review of published studies on the subject and a cross-sectional study investigating domain-specific cognitive impairment in people with COPD compared to people with known Alzheimer's dementia, and controls without known COPD or cognitive impairment. The aim of the study was to compare prevalence and pattern of cognitive impairment between the three groups using the Addenbrooke's Cognitive Examination (ACE)-III tool. A total of 89 participants were recruited (44 with COPD, 17 with Alzheimer's and 28 controls). Patients with COPD had significantly lower total ACE-III scores than controls (p<0.001). When comparing the COPD group to the known Alzheimer's dementia group, overall ACE-III scores were significantly lower in the Alzheimer's dementia group than the COPD group (p=0.019). The domain-specific scores for attention (p<0.004), memory (p<0.004) and fluency (p<0.001) were significantly lower in the Alzheimer's dementia group than the COPD group. Our result suggest that the COPD group were significantly more likely to have cognitive impairment than the healthy control group. This was supported by the results of a narrative review of the published literature. Our results show that the pattern of impairment in the COPD group is different to the pattern of impairment shown in the known Alzheimer's dementia group, with significant differences in the cognitive domains affected. These results are in keeping with the findings of other previously published studies included in the narrative review

Regulation of prostate-specific antigen expression

Steroid hormones are widely distributed, cholesterol-derived, small hydrophobic molecules. They mediate a variety of biological functions, including tissue development, differentiation and homeostasis. Mammalian steroid hormones (androgens, glucocorticoids, mineralocorticoids, estrogens and progestins) exert their function by binding to the corresponding intracellular steroid hormone receptor. This binding triggers a complex set of molecular events, including protein-protein and protein-DNA interactions

Opening the black box of selection

Peer reviewedPublisher PD

Selection into medicine : the predictive validity of an outcome-based procedure

Acknowledgements: The authors would like to thank Dr. Kelly Dore for valuable advice and sharing Computer-based Assessment for Sampling Personal characteristics (CASPer) assignments in order to develop our Situational Judgement Test and Angela Verheyen and Guus Smeets for their essential support in gathering data.Peer reviewedPublisher PD

Characterisation of the androgen regulation of glycine N-methyltransferase in prostate cancer cells

The development and growth of prostate cancer is dependent on androgens; thus, the identification of androgen-regulated genes in prostate cancer cells is vital for defining the mechanisms of prostate cancer development and progression and developing new markers and targets for prostate cancer treatment. GlycineN-methyltransferase (GNMT) is aS-adenosylmethionine-dependent methyltransferase that has been recently identified as a novel androgen-regulated gene in prostate cancer cells. Although the importance of this protein in prostate cancer progression has been extensively addressed, little is known about the mechanism of its androgen regulation. Here, we show that GNMT expression is stimulated by androgen in androgen receptor (AR) expressing cells and that the stimulation occurs at the mRNA and protein levels. We have identified an androgen response element within the first exon of theGNMTgene and demonstrated that AR binds to this elementin vitroandin vivo. Together, these studies identify GNMT as a direct transcriptional target of the AR. As this is an evolutionarily conserved regulatory element, this highlights androgen regulation as an important feature of GNMT regulation.</jats:p

Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter

Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity

Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth-stimulating properties of LNCaP cells

Androgen receptor-positive LNCaP cells were stably transfected with a rat glucocorticoid receptor (GR) expression plasmid. Ligand-binding studies in the generated cell lines revealed high-affinity binding of the cognate ligands to their receptors. Transfection experiments with the newly derived cell lines showed that, like androgen receptor, GR can induce activity of a prostate-specific antigen promoter fragment linked to the luciferase gene. Similarly, dexamethasone can stimulate expression of endogenous prostate-specific antigen messenger RNA. Cell proliferation could be induced by R1881. In contrast, dexamethasone treatment of the GR-positive sublines had no stimulatory effect on cell growth. Using the differential display technique, a so far unknown complementary DNA fragment, designated 21.1, specifically induced by androgens and not by glucocorticoids, has been identified. In conclusion, the newly generated cell lines, together with the parental LNCaP cell line, form an attractive system with which to study the mechanism of specificity of steroid hormone regulation of gene expression