Global Attractors of the Extensible Plate Equations with Nonlinear Damping and Memory

We prove in this paper the existence of a global attractor for the plate equations of Kirchhoff type with nonlinear damping and memory using the contraction function method

Zero sequence blocking transformers for multi-pulse rectifier in aerospace applications

The second session of the 109th Congress may well face decisions regarding the preparation of U.S. military forces for stability missions, a broad doctrinal term of which a major subset is peace operations. A November 28, 2005, Department of Defense (DOD) directive that designates stability operations as “core missions” of the U.S. military marks a major shift on the future necessity of performing peacekeeping and related stability operations (also known as stabilization and reconstruction operations)

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells

Bifurcation curves of positive solutions for one-dimensional Minkowski curvature problem

In this paper, we study the shape of the bifurcation curves of positive solutions for the one-dimensional Minkowski-curvature problem. By developing some new time mapping techniques, we find that the bifurcation curve is ⊂-shaped/monotone increasing/S-like shaped on the (λ,||u||∞) plane when the nonlinearity satisfies different assumptions. Finally, two examples are given to illustrate our result

Isobavachalcone exhibits antifungal and antibiofilm effects against C. albicans by disrupting cell wall/membrane integrity and inducing apoptosis and autophagy

Isobavachalcone (IBC) is a natural flavonoid with multiple pharmacological properties. This study aimed to evaluate the efficacy of IBC against planktonic growth and biofilms of Candida albicans (C. albicans) and the mechanisms underlying its antifungal action. The cell membrane integrity, cell metabolic viability, and cell morphology of C. albicans treated with IBC were evaluated using CLSM and FESEM analyses. Crystal violet staining, CLSM, and FESEM were used to assess the inhibition of biofilm formation, as well as dispersal and killing effects of IBC on mature biofilms. RNA-seq combined with apoptosis and autophagy assays was used to examine the mechanisms underlying the antifungal action of IBC. IBC exhibited excellent antifungal activity with 8 μg/mL of MIC for C. albicans. IBC disrupted the cell membrane integrity, and inhibited biofilm formation. IBC dispersed mature biofilms and damaged biofilm cells of C. albicans at 32 μg/mL. Moreover, IBC induced apoptosis and autophagy-associated cell death of C. albicans. The RNA-seq analysis revealed upregulation or downregulation of key genes involved in cell wall synthesis (Wsc1 and Fks1), ergosterol biosynthesis (Erg3, and Erg11), apoptisis (Hsp90 and Aif1), as well as autophagy pathways (Atg8, Atg13, and Atg17), and so forth, in response to IBC, as evidenced by the experiment-based phenotypic analysis. These results suggest that IBC inhibits C. albicans growth by disrupting the cell wall/membrane, caused by the altered expression of genes associated with β-1,3-glucan and ergosterol biosynthesis. IBC induces apoptosis and autophagy-associated cell death by upregulating the expression of Hsp90, and altering autophagy-related genes involved in the formation of the Atg1 complex and the pre-autophagosomal structure. Together, our findings provide important insights into the potential multifunctional mechanism of action of IBC