9,460 research outputs found

    A homoclinic tangle on the edge of shear turbulence

    Full text link
    Experiments and simulations lend mounting evidence for the edge state hypothesis on subcritical transition to turbulence, which asserts that simple states of fluid motion mediate between laminar and turbulent shear flow as their stable manifolds separate the two in state space. In this Letter we describe a flow homoclinic to a time-periodic edge state. Its existence explains turbulent bursting through the classical Smale-Birkhoff theorem. During a burst, vortical structures and the associated energy dissipation are highly localized near the wall, in contrast to the familiar regeneration cycle

    The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

    Get PDF
    The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

    Actors and factors - bridging social science findings and urban land use change modeling

    Get PDF
    Recent uneven land use dynamics in urban areas resulting from demographic change, economic pressure and the cities’ mutual competition in a globalising world challenge both scientists and practitioners, among them social scientists, modellers and spatial planners. Processes of growth and decline specifically affect the urban environment, the requirements of the residents on social and natural resources. Social and environmental research is interested in a better understanding and ways of explaining the interactions between society and landscape in urban areas. And it is also needed for making life in cities attractive, secure and affordable within or despite of uneven dynamics.\ud The position paper upon “Actors and factors – bridging social science findings and urban land use change modeling” presents approaches and ideas on how social science findings on the interaction of the social system (actors) and the land use (factors) are taken up and formalised using modelling and gaming techniques. It should be understood as a first sketch compiling major challenges and proposing exemplary solutions in the field of interest

    A new limit on the Ultra-High-Energy Cosmic-Ray flux with the Westerbork Synthesis Radio Telescope

    Get PDF
    A particle cascade (shower) in a dielectric, for example as initiated by an ultra-high energy cosmic ray, will have an excess of electrons which will emit coherent \v{C}erenkov radiation, known as the Askaryan effect. In this work we study the case in which such a particle shower occurs in a medium just below its surface. We show, for the first time, that the radiation transmitted through the surface is independent of the depth of the shower below the surface when observed from far away, apart from trivial absorption effects. As a direct application we use the recent results of the NuMoon project, where a limit on the neutrino flux for energies above 102210^{22}\,eV was set using the Westerbork Synthesis Radio Telescope by measuring pulsed radio emission from the Moon, to set a limit on the flux of ultra-high-energy cosmic rays.Comment: Accepted for publication in Phys. Rev.

    Evaluation of Container Overlays for Secure Data Sharing

    Get PDF
    • 

    corecore