Characterisation of Mitochondrial 12s rRNA Gene of Yellow Striped Chevrotain (Moschiola kathygre) and Development of a PCR-RFLP marker for the Unambiguous Identification of the Species

In the evolutionary studies of mammals, the study of Tragulids, commonly known as Chevrotains or mouse deer, is very important since they represent the basal branch of ruminants. They are the only members of the infraorder Tragulina and have not undergone significant changes since the Miocene period. Most of the Tragulids have become extinct leaving three genera to be found at present including, Tragulus, Hyemoschus, and Moschiola. The genus Moschiola consists of three species that can be found both in India (M. indica) and Sri Lanka (M. meminna and M. kathygre). The complete mitochondrial genome of Indian mouse deer has been sequenced recently but Sri Lankan mouse deer lacks molecular information. In the present study, the mitochondrial 12s rRNA gene sequence of Yellow striped Chevrotain (M. kathygre) was analysed with the objective of formulating a marker for the identification of the species. The genomic DNA from hair follicles was isolated and the 12s rRNA mitochondrial region was amplified using universal primers, forward primer 5’CAAACTGGGATTAGATACCCCACTAT 3’and reverse primer 5’GAGGGTGACGGGCGGTGTGT 3’. The sequence was compared with other deer species and the Indian Chevrotain. The Sri Lankan yellow striped chevrotain shared the highest sequence similarity of 91.19% with the Indian Chevrotain and above 89% similarity with other deer species. In silico analysis of 12s rRNA gene sequence revealed that a PCR-RFLP approach can be used to differentiate Yellow striped Chevrotain from the Indian Chevrotain using RsaI, BsrI, DraI and HinfI restriction enzymes.Keywords: Yellow striped chevrotain, Tragulids, 12s rRNA gene, PCR-RFL

Transpiration difference under high evaporative demand in chickpea ( Cicer arietinum L.) may be explained by differences in the water transport pathway in the root cylinder

Terminal drought substantially reduces chickpea yield. Reducing water use at vegetative stage by reducing transpiration under high vapor pressure deficit (VPD), i.e. under dry/ hot conditions, contributes to drought adaptation. We hypothesized that this trait could relate to differences in a genotype’s dependence on root water transport pathways and hydraulics. • Transpiration rate responses in conservative and profligate chickpea genotypes were evaluated under increasing VPD in the presence/absence of apoplastic and cell-to-cell transport inhibitors. • Conservative genotypes ICC 4958 and ICC 8058 restricted transpiration under high VPD compared to the profligate genotypes ICC 14799 and ICC 867. Profligate genotypes were more affected by aquaporin inhibition of the cell-to-cell pathway than conservative genotypes, as measured by the root hydraulic conductance and transpiration under high VPD. Aquaporin inhibitor treatment also led to a larger reduction in root hydraulic conductivity in profligate than in conservative genotypes. In contrast, blockage of the apoplastic pathway in roots decreased transpiration more in conservative than in profligate genotypes. Interestingly, conservative genotypes had high early vigour, whereas profligate genotypes had low early vigour. • In conclusion, profligate genotypes depend more on the cell-to-cell pathway, which might explain their higher root hydraulic conductivity, whereas water-saving by restricting transpiration led to higher dependence on the apoplastic pathway. This opens the possibility to screen for conservative or profligate chickpea phenotypes using inhibitors, itself opening to the search of the genetic basis of these differences

Chickpea Genotypes Contrasting for Vigor and Canopy Conductance Also Differ in Their Dependence on Different Water Transport Pathways

Lower plant transpiration rate (TR) under high vapor pressure deficit (VPD) conditions and early plant vigor are proposed as major traits influencing the rate of crop water use and possibly the fitness of chickpea lines to specific terminal drought conditions—this being the major constraint limiting chickpea productivity. The physiological mechanisms underlying difference in TR under high VPD and vigor are still unresolved, and so is the link between vigor and TR. Lower TR is hypothesized to relate to hydraulic conductance differences. Experiments were conducted in both soil (Vertisol) and hydroponic culture. The assessment of the TR response to increasing VPD showed that high vigor genotypes had TR restriction under high VPD, and this was confirmed in the early vigor parent and progeny genotype (ICC 4958 and RIL 211) having lower TR than the late vigor parent and progeny genotype (ICC 1882 and RIL 022). Inhibition of water transport pathways [apoplast and symplast (aquaporins)] in intact plants led to a lower transpiration inhibition in the early vigor/low TR genotypes than in the late vigor/high TR genotypes. De-rooted shoot treatment with an aquaporin inhibitor led to a lower transpiration inhibition in the early vigor/low TR genotypes than in the late vigor/high TR genotypes. Early vigor genotypes had lower root hydraulic conductivity than late vigor/high TR genotypes. Under inhibited conditions (apoplast, symplast), root hydraulic conductivity was reduced more in the late vigor/high TR genotypes than in the early vigor/low TR genotypes. We interpret that early vigor/low TR genotypes have a lower involvement of aquaporins in water transport pathways and may also have a smaller apoplastic pathway than high TR genotypes, which could explain the transpiration restriction under high VPD and would be helpful to conserve soil water under high evaporative demand. These findings open an opportunity for breeding to tailor genotypes with different “dosage” of these traits toward adaptation to varying drought-prone environments

Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome

Background Terminal drought stress leads to substantial annual yield losses in chickpea (Cicer arietinum L.). Adaptation to water limitation is a matter of matching water supply to water demand by the crop. Therefore, harnessing the genetics of traits contributing to plant water use, i.e. transpiration rate and canopy development dynamics, is important to design crop ideotypes suited to a varying range of water limited environments. With an aim of identifying genomic regions for plant vigour (growth and canopy size) and canopy conductance traits, 232 recombinant inbred lines derived from a cross between ICC 4958 and ICC 1882, were phenotyped at vegetative stage under well-watered conditions using a high throughput phenotyping platform (LeasyScan). Results Twenty one major quantitative trait loci (M-QTLs) were identified for plant vigour and canopy conductance traits using an ultra-high density bin map. Plant vigour traits had 13 M-QTLs on CaLG04, with favourable alleles from high vigour parent ICC 4958. Most of them co-mapped with a previously fine mapped major drought tolerance “QTL-hotspot” region on CaLG04. One M-QTL was found for canopy conductance on CaLG03 with the ultra-high density bin map. Comparative analysis of the QTLs found across different density genetic maps revealed that QTL size reduced considerably and % of phenotypic variation increased as marker density increased. Conclusion Earlier reported drought tolerance hotspot is a vigour locus. The fact that canopy conductance traits, i.e. the other important determinant of plant water use, mapped on CaLG03 provides an opportunity to manipulate these loci to tailor recombinants having low/high transpiration rate and plant vigour, fitted to specific drought stress scenarios in chickpea

Neutrosophic Spherical Cubic Sets

In this paper, a new concept of Neutrosophic Spherical Cubic Set (NSCS) is introduced as an amalgamation of sets such as Neutrosophic, Interval valued, cubic and spherical sets. We studied the concepts of internal and external neutrosophic spherical cubic sets and discussed their basic properties. Further P-order, P-union, P-intersection as well as R-order, R-union, R-intersection are discussed for NSCSs

Chickpea Genotypes Contrasting for Vigor and Canopy Conductance Also Differ in Their Dependence on Different Water Transport Pathways

Lower plant transpiration rate (TR) under high vapor pressure deficit (VPD) conditions and early plant vigor are proposed as major traits influencing the rate of crop water use and possibly the fitness of chickpea lines to specific terminal drought conditions—this being the major constraint limiting chickpea productivity. The physiological mechanisms underlying difference in TR under high VPD and vigor are still unresolved, and so is the link between vigor and TR. Lower TR is hypothesized to relate to hydraulic conductance differences. Experiments were conducted in both soil (Vertisol) and hydroponic culture. The assessment of the TR response to increasing VPD showed that high vigor genotypes had TR restriction under high VPD, and this was confirmed in the early vigor parent and progeny genotype (ICC 4958 and RIL 211) having lower TR than the late vigor parent and progeny genotype (ICC 1882 and RIL 022). Inhibition of water transport pathways [apoplast and symplast (aquaporins)] in intact plants led to a lower transpiration inhibition in the early vigor/low TR genotypes than in the late vigor/high TR genotypes. De-rooted shoot treatment with an aquaporin inhibitor led to a lower transpiration inhibition in the early vigor/low TR genotypes than in the late vigor/high TR genotypes. Early vigor genotypes had lower root hydraulic conductivity than late vigor/high TR genotypes. Under inhibited conditions (apoplast, symplast), root hydraulic conductivity was reduced more in the late vigor/high TR genotypes than in the early vigor/low TR genotypes. We interpret that early vigor/low TR genotypes have a lower involvement of aquaporins in water transport pathways and may also have a smaller apoplastic pathway than high TR genotypes, which could explain the transpiration restriction under high VPD and would be helpful to conserve soil water under high evaporative demand. These findings open an opportunity for breeding to tailor genotypes with different “dosage” of these traits toward adaptation to varying drought-prone environments

Molecular cloning and expression analysis of Aquaporin genes in pearl millet [ Pennisetum glaucum (L) R. Br.] genotypes contrasting in their transpiration response to high vapour pressure deficits

Pearl millet is a crop of the semi-arid tropics having high degree of genetic diversity and variable tolerance to drought stress. To investigate drought tolerance mechanism that possibly accounts for differences in drought tolerance, four recombinant inbred lines from a high resolution cross (HRC) were selected for variability in their transpiration rate (Tr) response to vapour pressure deficit (VPD) conditions. The differential Tr response of the genotypes to increased VPD conditions was used to classify the genotypes as sensitive or insensitive to high VPD. Aquaporin (AQP) genes PgPIP1;1, PgPIP1;2, PgPIP2;1, PgPIP2;3, PgPIP2;6, PgTIP1;1 and PgTIP2;2 were cloned. Phylogenetic analysis revealed that the cloned PgAQPs were evolutionarily closer to maize AQPs than to rice. PgAQP genes, including PgPIP1;1 and PgPIP2;6 in root tissue showed a significant expression pattern with higher expression in VPD-insensitive genotypes than VPD-sensitive genotypes under low VPD conditions (1.2 kPa) i.e when there is no high evaporative demand from the atmosphere. PgAQP genes (PgPIP2;1 in leaf and root tissues; PgPIP1;2 and PgTIP2;2 in leaf and PgPIP2;6 in root) followed a diurnal rhythm in leaves and roots that have either higher or lower expression levels at different time intervals. Under high VPD conditions (4.21 kPa), PgPIP2;3 showed higher transcript abundance in VPD-insensitive genotypes, and PgPIP2;1 in VPD-sensitive genotypes, while rest of the PgAQPs showed differential expression. Our current hypothesis is that these differences in the expression of AQP genes under different VPDs suggests a role of the AQPs in tuning the water transport pathways with variation between genotypes

LeasyScan: 3D scanning of crop canopy plus seamless monitoring of water use to harness the genetics of key traits for drought adaptation

With the genomics revolution in full swing, relevant phenotyping is now a main bottleneck. New imaging technologies provide opportunities for easier, faster and more informative phenotyping of many plant parameters. However, it is critical that the development of automated phenotyping be driven by a clear framing of target phenotypes rather than by a technological push, especially for complex constraints. Previous studies on drought adaptation shows the importance of water availability during the grain filling period, which depends on traits controlling the plant water budget at earlier stages. We will then discuss “cause” and “consequence” in phenotypes. Drawing on this, a phenotyping platform (LeasyScan) was developed to target canopy development and conductance traits. Based on a novel 3D scanning technique to capture leaf area development continuously and a scanner-to-plant concept to increase imaging throughput, LeasyScan is also equipped with 1488 analytical scales to measure transpiration seamlessly. Examples of the first applications are presented: (i) to compare the leaf area development pattern of pearl millet breeding material targeted to different agro-ecological zones, (ii) for the mapping of QTLs for vigour traits in chickpea, shown to co-map with an earlier reported “drought tolerance” QTL; (iii) for the mapping of leaf area development in pearl millet; (iv) for assessing the transpiration response to high vapour pressure deficit in different crops. This new platform has the potential to phenotype traits controlling plant water use at a high rate and precision, opening the opportunity to harness their genetics towards breeding improved varieties