FAKTOR-FAKTOR YANG MEMPENGARUHI PATOGENITAS TRICHOMONAS VAGINALIS

Trichomonas vaginalis is a flagellated protozoan parasite that causes trichomoniasis. Trichomoniasis is a non-viral sexually transmitted infection and is found in the human urogenital tract. The interaction between T. vaginalis with the host is very complex and many factors influence the pathogenicity of T. vaginalis. To determine the factors that influence the pathogenicity of Trichomonas vaginalis. Literature review using the Google Scholar database. The search results for articles matched the criteria with the keyword "pathogenicity of Trichomonas vaginalis". Pathogenicity factors include changes in the trophozoite Trichomonas vaginalis to an ameboid form, cellular pathogenicity (attachment of Trichomonas vaginalis to host cells, cytotoxic and hemolytic activity, phagocytosis), interactions with vaginal flora, symbiont contribution with Trichomonas vaginalis, recognition by the host immune system, and evasion host immune system. Pathogenicity factors include changes in the trophozoite Trichomonas vaginalis to an ameboid form, cellular pathogenicity (attachment of Trichomonas vaginalis to host cells, cytotoxic and hemolytic activity, phagocytosis), interactions with vaginal flora, symbiont contribution with Trichomonas vaginalis, recognition by the host immune system, and evasion host immune system

Pengaruh Infeksi Toxoplasma gondii terhadap Bentuk Kepribadian dan Aktifitas Psikomotor pada Manusia

Abstrak Toksoplasmosis merupakan infeksi Toxoplasma gondii yang tersebar luas di negara berkembang maupun negara maju. Prevalensi toksoplasmosis bervariasi antara 2% – 80%. Toksoplasmosis umumnya tidak menimbulkan gejala, namun penelitian terkini menunjukkan bahwa toksoplasmosis laten dapat menyebabkan perubahan perilaku pada hewan pengerat, yang diinterprestasikan sebagai adaptasi khusus parasit untuk meningkatkan probabilitas transmisi dari hospes perantara ke hospes definitif dengan cara pemangsaan. Perbedaan antara manusia dewasa yang terinfeksi dengan yang tidak terinfeksi dibuktikan dengan kuesioner uji kepribadian. Hasilnya memperlihatkan perbedaan pola perilaku dan penurunan psikomotor pada manusia yang terinfeksi. T gondii. Perubahan tersebut dipengaruhi oleh kadar dopamin dan testosteron meskipun mekanismenya belum jelas diketahui. Kata kunci : toksoplamosis laten, personalitas, penurunan aktivitas psikomotor Abstract Toxoplasmosis is an infection due to Toxoplasma gondii , which is largely spreading both in the developing and developed countries. The toxoplasmosis prevalence variably between 2% to 80%. In general, toxoplasmosis do not showing symptoms. However, the newest research suggested that latent toxoplasmosis could cause behavior changes in the gnaw animal. It could be interpreted as parasite specific adaptation to augment the transmission probability from the intermediate to the definitive host by predatory. The comparison between the infected adult and the not infected by personality test questionnaire showed difference behavior pattern and psychomotoric decrease in the infected human. The personality change and the psychomotor decrease in human by the T. gondii is influenced by the dopamine and testosterone level, although the mechanism is not understood yet. Key words: latent toxoplasmosis, personality, psychomotoric activity decreas

Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia

Intestinal Parasitic Infections and Hemoglobin Levels among Schoolchildren participating in a Deworming Program in Jakarta, Indonesia: A Cross-sectional Study

BACKGROUND: Deworming programs have had positive impacts on the incidence of intestinal parasitic infections (IPIs) and hemoglobin (Hb) levels among schoolchildren. AIM: This study aimed to evaluate effects of a deworming program on IPIs and Hb levels among schoolchildren in Jakarta, Indonesia. METHODS: A cross-sectional study was performed in one school in Jakarta, Indonesia. Stool samples from schoolchildren were examined using the direct smear and Kato-Katz methods. The Hb concentrations of the schoolchildren were measured using the Easy Touch GCHb tool kit. RESULTS: A total of 219 stool samples were obtained, and 18.7% (41/219) were positive for IPIs; specifically 8.2% (18/219) were positive for helminth and 10.5% (23/219) were positive for protozoan infections. The prevalences of Ascaris lumbricoides and Trichuris trichiura were 6.4% and 1.8%, respectively. The prevalences of Blastocystis hominis, Giardia lamblia, Entamoeba histolytica, and Entamoeba coli were 6.8%, 2.7%, 0.5%, and 0.5%, respectively. The prevalence of anemia (Hb < 11.5 g/dL) among the schoolchildren was 19.6% (43/219). The IPIs were significantly associated with Hb concentrations among the schoolchildren (p < 0.05). CONCLUSION: The results of this study support the use of integrated programs involving deworming, nutrient supplementation, development of good living conditions, use of sanitary facilities, and active participation in the community to reduce IPIs and to improve the nutritional status among schoolchildren

Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia

Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang & Ho. Two methods described by Weiss et al and Chang & Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5’GGAACTGCATCCGTTCAGA G3’ and oligo 2 : 5’TCTTTAAAGCGTTCGTGGTC3’, whereas the P30 gene primers consisted of oligo 1 : 5’CACACGGTTGTATGTCGGTTTCG CT3’ and oligo 2 : 5’TCAAGG AGCTCAAT GTTACAGCCT3’. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang & Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.&nbsp

Assessing Minimal Concentration of Toxoplasma Gondii B1 and P30 Gen Which Are Still Detectable By Polymerase Reaction Chain

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets. The PCR against B1 gene as target was performed by using the method described by Chang and Ho. Two methods described by Weiss et al and Chang Ho were used against P30 gene as target. The B1 gene primers consisted of oligo 1 :5' GGAACTGCATCCGTTCAGA G3 and oligo 2 : 5'TCTTTAAAGCGTTCGTGGTC3, whereas the P30 gene primers consisted of oligo 1 : 5'CACACGGTTGTATGTCGGTTTCG CT3 and oligo 2 : 5'TCAAGG AGCTCAAT GTTACAGCCT3. It was shown that no specific bands were observed in the PCR with P30 gene as target using the method by Weiss et al. With the method Chang Ho the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target

Infeksi Parasit dan Jamur pada Pasien HIV

Abstrak Infeksi HIV yang dapat berakhir dengan AIDS merupakan ancaman bagi penduduk dunia masa kini. Banyak infeksi oportunistik yang menyertai penderita AIDS dengan manifestasi gangguan pada sistim pernafasan, pencernaan, dan otak. Di bawah ini diuraikan secara singkat gejala, diagnosis dan pengobatan parasite dan jamur yang berperan menyebabkan gangguan pada ketiga sistem tersebut hasil temuan di laboratorium Parasitologi FKUI. Kata Kunci : Candida, Cryptocaccus, Toxoplasma, Blastocystis, Cryptoporiditium   Abstract HIV infection, which ends up in AIDS, is a globally human life threatening disease. There are may co-infection due to the opportunistic organism which might cause disturbances in the respiratory system, digestive tract, and central neural system. In this paper, the signs, diagnosis and the treatment of parasitic and fungal infection in the system mentioned above would be discussed based on the study conducted in the FKUI’s Departement of Parasitology. Key words : Candida, Cryptocaccus, Toxoplasma, Blastocystis, Cryptoporiditiu

Diagnosis of malaria by the rapid manual test

[no abstract available