166 research outputs found
Genome Sequences of the Race 1 and Race 4 Xanthomonas campestris pv. campestris Strains CFBP 1869 and CFBP 5817
Xanthomonas campestris pv. campestris is the causal agent of black rot on Brassicaceae. The draft genome sequences of strains CFBP 1869 and CFBP 5817 have been determined and are the first ones corresponding to race 1 and race 4 strains, which have a predominant agronomic and economic impact on cabbage cultures worldwide
Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli
Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer
Generation and analysis of a mouse intestinal metatranscriptome through Illumina based RNA-sequencing
With the advent of high through-put sequencing (HTS), the emerging science of metagenomics is transforming our understanding of the relationships of microbial communities with their environments. While metagenomics aims to catalogue the genes present in a sample through assessing which genes are actively expressed, metatranscriptomics can provide a mechanistic understanding of community inter-relationships. To achieve these goals, several challenges need to be addressed from sample preparation to sequence processing, statistical analysis and functional annotation. Here we use an inbred non-obese diabetic (NOD) mouse model in which germ-free animals were colonized with a defined mixture of eight commensal bacteria, to explore methods of RNA extraction and to develop a pipeline for the generation and analysis of metatranscriptomic data. Applying the Illumina HTS platform, we sequenced 12 NOD cecal samples prepared using multiple RNA-extraction protocols. The absence of a complete set of reference genomes necessitated a peptide-based search strategy. Up to 16% of sequence reads could be matched to a known bacterial gene. Phylogenetic analysis of the mapped ORFs revealed a distribution consistent with ribosomal RNA, the majority from Bacteroides or Clostridium species. To place these HTS data within a systems context, we mapped the relative abundance of corresponding Escherichia coli homologs onto metabolic and protein-protein interaction networks. These maps identified bacterial processes with components that were well-represented in the datasets. In summary this study highlights the potential of exploiting the economy of HTS platforms for metatranscriptomics
Genomic and Evolutionary Features of the SPI-1 Type III Secretion System That Is Present in Xanthomonas albilineans but Is Not Essential for Xylem Colonization and Symptom Development of Sugarcane Leaf Scald
Xanthomonas albilineans is the causal agent of sugarcane leaf scald. Interestingly, this bacterium, which is not known to be insect or animal associated, possesses a type III secretion system (T3SS) belonging to the injectisome family Salmonella pathogenicity island 1 (SPI-1). The T3SS SPI-1 of X. albilineans shares only low similarity with other available T3SS SPI-1 sequences. Screening of a collection of 128 plant-pathogenic bacteria revealed that this T3SS SPI-1 is present in only two species of Xanthomonas: X. albilineans and X. axonopodis pv. phaseoli. Inoculation of sugarcane with knockout mutants showed that this system is not required by X. albilineans to spread within xylem vessels and to cause disease symptoms. This result was confirmed by the absence of this T3SS SPI-1 in an X. albilineans strain isolated from diseased sugarcane. To investigate the importance of the T3SS SPI-1 during the life cycle of X. albilineans, we analyzed T3SS SPI-1 sequences from 11 strains spanning the genetic diversity of this species. No nonsense mutations or frameshifting indels were observed in any of these strains, suggesting that the T3SS SPI-1 system is maintained within the species X. albilineans. Evolutionary features of T3SS SPI-1 based on phylogenetic, recombination, and selection analyses are discussed in the context of the possible functional importance of T3SS SPI-1 in the ecology of X. albilineans
Natural Genetic Variation of Xanthomonas campestris pv. campestris Pathogenicity on Arabidopsis Revealed by Association and Reverse Genetics
The pathogenic bacterium Xanthomonas campestris pv. campestris, the causal agent of black rot of Brassicaceae, manipulates the physiology and the innate immunity of its hosts. Association genetic and reverse-genetic analyses of a world panel of 45 X. campestris pv. campestris strains were used to gain understanding of the genetic basis of the bacterium’s pathogenicity to Arabidopsis thaliana. We found that the compositions of the minimal predicted type III secretome varied extensively, with 18 to 28 proteins per strain. There were clear differences in aggressiveness of those X. campestris pv. campestris strains on two Arabidopsis natural accessions. We identified 3 effector genes (xopAC, xopJ5, and xopAL2) and 67 amplified fragment length polymorphism (AFLP) markers that were associated with variations in disease symptoms. The nature and distribution of the AFLP markers remain to be determined, but we observed a low linkage disequilibrium level between predicted effectors and other significant markers, suggesting that additional genetic factors make a meaningful contribution to pathogenicity. Mutagenesis of type III effectors in X. campestris pv. campestris confirmed that xopAC functions as both a virulence and an avirulence gene in Arabidopsis and that xopAM functions as a second avirulence gene on plants of the Col-0 ecotype. However, we did not detect the effect of any other effector in the X. campestris pv. campestris 8004 strain, likely due to other genetic background effects. These results highlight the complex genetic basis of pathogenicity at the pathovar level and encourage us to challenge the agronomical relevance of some virulence determinants identified solely in model strains.IMPORTANCE The identification and understanding of the genetic determinants of bacterial virulence are essential to be able to design efficient protection strategies for infected plants. The recent availability of genomic resources for a limited number of pathogen isolates and host genotypes has strongly biased our research toward genotype-specific approaches. Indeed, these do not consider the natural variation in both pathogens and hosts, so their applied relevance should be challenged. In our study, we exploited the genetic diversity of Xanthomonas campestris pv. campestris, the causal agent of black rot on Brassicaceae (e.g., cabbage), to mine for pathogenicity determinants. This work evidenced the contribution of known and unknown loci to pathogenicity relevant at the pathovar level and identified these virulence determinants as prime targets for breeding resistance to X. campestris pv. campestris in Brassicaceae
Evolutionary History of the Plant Pathogenic Bacterium Xanthomonas axonopodis
Deciphering mechanisms shaping bacterial diversity should help to build tools to predict the emergence of infectious diseases. Xanthomonads are plant pathogenic bacteria found worldwide. Xanthomonas axonopodis is a genetically heterogeneous species clustering, into six groups, strains that are collectively pathogenic on a large number of plants. However, each strain displays a narrow host range. We address the question of the nature of the evolutionary processes – geographical and ecological speciation – that shaped this diversity. We assembled a large collection of X. axonopodis strains that were isolated over a long period, over continents, and from various hosts. Based on the sequence analysis of seven housekeeping genes, we found that recombination occurred as frequently as point mutation in the evolutionary history of X. axonopodis. However, the impact of recombination was about three times greater than the impact of mutation on the diversity observed in the whole dataset. We then reconstructed the clonal genealogy of the strains using coalescent and genealogy approaches and we studied the diversification of the pathogen using a model of divergence with migration. The suggested scenario involves a first step of generalist diversification that spanned over the last 25 000 years. A second step of ecology-driven specialization occurred during the past two centuries. Eventually, secondary contacts between host-specialized strains probably occurred as a result of agricultural development and intensification, allowing genetic exchanges of virulence-associated genes. These transfers may have favored the emergence of novel pathotypes. Finally, we argue that the largest ecological entity within X. axonopodis is the pathovar
A multiplex-PCR assay for identification of the quarantine plant pathogen Xanthomonas axonopodis pv. phaseoli
In this study we developed an algorithm to screen for all exact molecular signatures of the quarantine pathogen Xanthomonas axonopodis pv. phaseoli (Xap), based on available data of the presence or absence of virulence-associated genes. The simultaneous presence of genes avrBsT and xopL is specific to Xap. Therefore we developed a multiplex PCR assay targeting avrBsT and xopL for the molecular identification of Xap. The specificity of this multiplex was validated by comparison to that of other molecular identification assays aimed at Xap, on a wide collection of reference strains. This multiplex was further validated on a blind collection of Xanthomonas isolates for which pathogenicity was assayed by stem wounding and by dipping leaves into calibrated inocula. This multiplex was combined to the previously described X4c/X4e molecular identification assay for Xap. Such a combination enables the molecular identification of all strains of Xanthomonas pathogenic on bean. Results also show that assay by stem wounding does not give reliable results in the case of Xap, and that pathogenicity assays by dipping should be preferred
Back to Massey: Impressively fast, scalable and tight security evaluation tools
None of the existing rank estimation algorithms can scale to large cryptographic
keys, such as 4096-bit (512 bytes) RSA keys. In this paper, we present the first
solution to estimate the guessing entropy of arbitrarily large keys, based on
mathematical bounds, resulting in the fastest and most scalable security
evaluation tool to date. Our bounds can be computed within a fraction of a second, with
no memory overhead, and provide a margin of only a few bits for a full 128-bit
AES key
- …