Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. The research was conducted using experimental methods with a completely randomized design. The research material was 100 male day old chickens of Sentul. The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.. Each experimental unit consisted of 5 chickens and 4 replications. The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks. Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT. Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program. Analysis of variance showed that there were no significant differences (P> 0.05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens. The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank. The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC. The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene. Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic

Reproductive Performance of Various Breeds of Sentul Chicken

This study was conducted to determine the reproductive performance of various breeds of Sentul chicken. The present research was assigned in an experimental model with a completely randomized design (CRD), with 5 breeds of Sentul chicken were created as treatments, namely Abu Sentul chicken = SA; Batu Sentul Chicken=SB; Emas Sentul Chicken=SE; Debu Sentul Chicken=SD; and Geni Sentul Chicken=SG. Each treatment was repeated 5 times with 4 females and 1 male birds each, thus the total number of chickens were 100 females and 25 males with an average initial female weight was 1,336.05 ± 84,99 g and male weight was 2,050.53 ± 121,78 g. The experiment was conducted for 14 weeks started from 20 week old until 34 week old. Variables measured were spermatozoa production, fertility, and hatchability. Data were subjected to analysis of variance and HSD test. Results showed that various breeds of Sentul chicken had no significant effect (P>0.05) on spermatozoa production, and had significant effect (P<0.05) on fertility and hatchability. It can be concluded that spermatozoa production of various breeds of Sentul chicken are relatively similar, while fertility and hatchability of Emas chicken was lower than that of Abu Sentul chicken and Batu Sentul Chicken

Rancang Bangun Sistem Monitor Radiasi Gamma Dilengkapi Transmitter Signal 4-20ma pada Instalasi Pengolahan Bahan Bakar Nuklir

RANCANG BANGUN SISTEM MONITOR RADIASI GAMMA DILENGKAPI TRANSMITTER SIGNAL 4-20 mA. Pengukuran sistem radiasi gamma yang dilengkapi transmisi signal 4-20 mA adalah suatu pilihan untuk diaplikasikan pada instalasi pengolahan bahan bakar nuklir. Sistem monitor gamma ini dapat dengan mudah diintegrasikan dengan elektronik data logger dan Komputer Proses didalam gedung yang dindingnya tebal tidak bisa ditembus leh frekwensi radio. Sistem ini tersusun dari detektor Sintilasi modul pulse shaping modul lokal display bersatuan µSv/h dan modul transmitter 4-20 mA. Data hasil pembacaan sistem monitor radiasi gamma ini dikirim menggunakan standar sinyal berbentuk pulsa yang kemudian dikonversi menjadi standar sinyal berbentuk arus 4-20 mA oleh modul elektronik transmitter sinyal 4-20 mA. Sinyal ini kemudian dikirim melalui kabel sepanjang 700 meter ke ruang kendali utama. Hasil rancang bangun sistem monitor radiasi gamma dengan kelengkapan transmitter sinyal 4-20mA ini telah diuji dibandingkan dengan survey meter gamma tersertifikasi PTKMR dan menghasilkan nilai penyimpangan pengukuran rata rata sebesar +8,7 % serta koefisien linier antara bacaan surveymeter dengan sistem monitor radiasi gamma adalah r = 0,986. Kata kunci : Monitor radiasi gamma, transmitter signal 4-20m

Effect of Number of Spermatozoa, Oviduct Condition and Timing of Artificial Insemination on Fertility and Fertile Period of Kampung Rooster Spermatozoa

Abstract. This study was carried out to determine the optimum fertility and fertile period using the number of spermatozoa, oviduct condition and timing of insemination of native rooster spermatozoa. Ninety six commercial Isa brown pullets and nine kampung roosters were used in this study in a 3×2×2 factorial arrangement with one bird in a cage constituting a unit. The factor levels were the number of spermatozoa (50, 100 and 150 million/0.1 ml), oviduct condition (hard-shelled eggs and free hard-shelled eggs), and timing of artificial insemination (in the morning, at 7 AM and in the afternoon, at 4 PM).  The results showed that among the treatments there was no significant interaction to fertility and fertile period. Insemination with 50 million sperm number seemed to be the same result with the other 2 treatments. Oviduct condition had a highly significant difference on fertility and fertile period percentage, and timing of insemination did not differ between morning and afternoon.  In conclusion, the only oviduct condition (free hard-shelled eggs) was the best results for insemination in terms of fertility and fertile period of native roosters.  It is recommended that for the maximum fertility and fertile period, hens should be inseminated with 50 million spermatozoa, free of hard-shelled eggs and insemination performed in the morning or in the afternoon.   Keywords: timing of artificial insemination, fertility, fertile period, semen dose, oviduct condition Animal Production 14(1):32-36, January 201

Raising Ducks Using Feed Supplementedwith Tea Dregs In Karang Taruna “Tunas Harum-2” Kaliputih Village, Purwojati Municipality, Banyumas

Rice field constitutes 70 percent of Kaliputih village in Purwojati municipality, Banyumas and half of the community are farmers. İt motivated the community and Karang Taruna 'Tunas Harum -2' to raise ducks, but they faced some issues of obtaining DOD and high mortality of ducks. Therefore, it required some innovation to solve the problems, namely artificial insemination, hatching eggs in an incubator, feed processing by utilizing the available agricultural waste, and incorporating antioxidants from waste, tea dregs. &nbsp;Tugiyanti et al. (2019) reported that fermented tea dreg contains high antioxidants that could improve duck health and the quality of duck eggs and meat. This community service engaged an extension/technology adoption program through seminars, practice/demo, evaluation as well as training for instructors. The materials (theory and practice) designed for the members of Karang Taruna included the method of duck farming, artificial insemination for ducks, tea dreg fermentation, methods for feed formulation, and incorporating 3% tea dreg to the feed and practice hatching eggs in an incubator. The participants, including the village government officials and the community, had successfully partaken in the process of technology transfer and practice. Conclusively, the community service program can modify the community habit in duck farming and solve issues regarding DOD, feed, and production. &nbsp