The asymmetric profile of the H76 alpha line emission from MWC349

MWC349 is an emission-line star found by Merrill, Humason and Burwell (1932). Braes, Habing and Schoenmaker (1972) discovered that it is a strong radio source. The radio emission originates in a massive ionized wind that is expanding with a velocity of about 50 km s(-1). Its continuum spectrum fits well a nu(0.6) power law from the cm wavelengths to the far-IR. Radio recombination line emission from the envelope of MWC349 was first detected by Altenhoff, Strittmatter and Wendker (1981). We have obtained good signal-to-noise ratio, Very Large Array observations of the H76 alpha radio recombination line from the ionized wind of MWC349. Our data reveal that the profile is markedly asymmetric, with a steep rise on the blue side. This asymmetry could be due to non-LTE effects in the formation and transfer of the line or to intrinsic asymmetries in the envelope. Our analysis suggests that most probably the peculiar profile is caused by a non-LTE enhancement of the line emission from the side of the envelope nearer to the observer. This asymmetry has the opposite sense than that observed in optical and IR recombination lines, where a different effect (absorption of the stellar continuum by the gas in the wind between the star and the observer) is known to be dominant, leading to the classic P Cygni profile. We propose that the profiles of the radio recombination lines from ionized stellar winds will have this characteristic shape, while optical and IR recombination lines are characterized by P Cygni-like profiles. Unfortunately, at present the detection of radio recombination lines from ionized stellar winds is only feasible for MWC349 and a few other objects

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Stereomicroscope Inspection of Polished Aluminum Collector 50684.0

The Genesis polished aluminum "kidney" collector was damaged during the hard landing of the capsule on September 8, 2004 in the Utah desert. The kidney was introduced into the Genesis (ISO class 4) cleanroom laboratory on November 4, 2004 and stored under nitrogen cover gas. The collector is currently fastened to a highly polished stainless steel plate for secure handling. Curatorial work at JSC has made successful subdivision and subsequent allocation of samples from the kidney

Genesis Concentrator Target Particle Contamination Mapping and Material Identification

The majority of surface particles were found to be < 5 microns in diameter with increasing numbers close to the optical resolution limit of 0.3 microns. Acceleration grid EDS results show that the majority of materials appear to be from the SRC shell and SLA materials which include carbon-carbon fibers and Si-rich microspheres in a possible silicone binder. Other major debris material from the SRC included white paint, kapton, collector array fragments, and Al. Image analysis also revealed that SRC materials were also found mixed with the Utah mud and salt deposits. The EDS analysis of the acceleration grid showed that particles < 1 m where generally carbon based particles. Chemical cleaning techniques with Xylene and HF in an ultrasonic bath are currently being investigated for removal of small particles by the Genesis science team as well as ultra-pure water megasonic cleaning by the JSC team [4]. Removal of organic contamination from target materials is also being investigated by the science team with the use of UV-ozone cleaning devices at JSC and Open University [5]. In preparation for solar wind oxygen analyses at UCLA and Open University [1, 2], surface particle contamination on three Genesis concentrator targets was closely examined to evaluate cleaning strategies. Two silicon carbide (Genesis sample # 60001 and 60003) and one chemical vapor deposited (CVD) 13C concentrator target (60002) were imaged and mosaic mapped with optical microscopes. The resulting full target mosaic images and particle feature maps were subsequently compared with non-flight, but flight-like, concentrator targets and sample return capsule (SRC) materials. Contamination found on the flown concentrator acceleration grid was further examined using a scanning electron microscope (SEM). Energy dispersive X-ray spectroscopy (EDS) for particle identification was subsequently compared with the optical images from the flown targets. Figure 1 show that all three targets imaged in this report are fully intact and do not show any signs of material fractures. However, previous ellipsometry results and overview imaging of both flown SiC targets show a solar wind irradiation gradient from the center focal point to the outer edge [3]. In addition, due to the hard landing, each target has experienced varying degrees of impacts, scratches, and particle debris from the spacecraft and Utah impact site

Preliminary Quantification of Image Color Gradient on Genesis Concentrator Silicon Carbine Target 60001

The Genesis spacecraft concentrator was a device to focus solar wind ions onto a 6-cm diameter target area, thus concentrating the solar wind by 20X [1]. The target area was comprised of 4 quadrants held in place by a gold-coated stainless steel "cross" (Fig. 1). To date, two SiC and one chemical vapor deposited (CVD) quadrants have been imaged at 5X using a Leica DM-6000M in autoscan mode. Complete imaging of SiC sample 60001 required 1036 images. The mosaic of images is shown in Fig. 2 and position of analyzed areas in Fig. 3. This mosaic imaging is part of the curatorial documentation of surface condition and mapping of contamination. Higher magnification (50X) images of selected areas of the target and individual contaminant particles are compiled into reports which may be requested from the Genesis Curator [2]

Genesis Silicon Carbide Concentrator Target 60003 Preliminary Ellipsometry Mapping Results

The Genesis concentrator was custom designed to focus solar wind ions primarily for terrestrial isotopic analysis of O-17/O-16 and O-18/O-16 to +/-1%, N-15/N-14 to +/-1%, and secondarily to conduct elemental and isotopic analysis of Li, Be, and B. The circular 6.2 cm diameter concentrator target holder was comprised of four quadrants of highly pure semiconductor materials that included one amorphous diamond-like carbon, one C-13 diamond, and two silicon carbide (SiC). The amorphous diamond-like carbon quadrant was fractured upon impact at Utah Test and Training Range (UTTR), but the remaining three quadrants survived fully intact and all four quadrants hold an important collection of solar wind. The quadrants were removed from the target holder at NASA Johnso n Space Center Genesis Curation Laboratory in April 2005, and have been housed in stainless steel containers under continual nitrogen purge since time of disintegration. In preparation for allocation of a silicon carbide target for oxygen isotope analyses at UCLA, the two SiC targets were photographed for preliminary inspection of macro particle contamination from the hard non-nominal landing as well as characterized by spectroscopic ellipsometry to evaluate thin film contamination. This report is focused on Genesis SiC target sample number 60003

Cleaning Genesis Solar Wind Collectors with Ultrapure Water: Residual Contaminant Particle Analysis

Additional experience has been gained in removing contaminant particles from the surface of Genesis solar wind collectors fragments by using megasonically activated ultrapure water (UPW)[1]. The curatorial facility has cleaned six of the eight array collector material types to date: silicon (Si), sapphire (SAP), silicon-on-sapphire (SOS), diamond-like carbon-on-silicon (DOS), gold-on-sapphire (AuOS), and germanium (Ge). Here we make estimates of cleaning effectiveness using image analysis of particle size distributions and an SEM/EDS reconnaissance of particle chemistry on the surface of UPW-cleaned silicon fragments (Fig. 1). Other particle removal techniques are reported by [2] and initial assessment of molecular film removal is reported by [3]

Decontaminating Solar Wind Samples with the Genesis Ultra-Pure Water Megasonic Wafer Spin Cleaner

The Genesis sample return capsule, though broken during the landing impact, contained most of the shattered ultra-pure solar wind collectors comprised of silicon and other semiconductor wafers materials. Post-flight analysis revealed that all wafer fragments were littered with surface particle contamination from spacecraft debris as well as soil from the impact site. This particulate contamination interferes with some analyses of solar wind. In early 2005, the Genesis science team decided to investigate methods for removing the surface particle contamination prior to solar wind analysis

Using Light Curves to Characterize Size and Shape of Pseudo-Debris

Photometric measurements were collected for a new study aimed at estimating orbital debris sizes based on object brightness. To obtain a size from optical measurements the current practice is to assume an albedo and use a normalized magnitude to calculate optical size. However, assuming a single albedo value may not be valid for all objects or orbit types; material type and orientation can mask an object s true optical cross section. This experiment used a CCD camera to record data, a 300 W Xenon, Ozone Free collimated light source to simulate solar illumination, and a robotic arm with five degrees of freedom to move the piece of simulated debris through various orientations. The pseudo-debris pieces used in this experiment originate from the European Space Operations Centre s ESOC2 ground test explosion of a mock satellite. A uniformly illuminated white ping-pong ball was used as a zero-magnitude reference. Each debris piece was then moved through specific orientations and rotations to generate a light curve. This paper discusses the results of five different object-based light curves as measured through an x-rotation. Intensity measurements, from which each light curve was generated, were recorded in five degree increments from zero to 180 degrees. Comparing light curves of different shaped and sized pieces against their characteristic length establishes the start of a database from which an optical size estimation model will be derived in the future

Calculating Statistical Orbit Distributions Using GEO Optical Observations with the Michigan Orbital Debris Survey Telescope (MODEST)

NASA's Orbital Debris measurements program has a goal to characterize the small debris environment in the geosynchronous Earth-orbit (GEO) region using optical telescopes ("small" refers to objects too small to catalog and track with current systems). Traditionally, observations of GEO and near-GEO objects involve following the object with the telescope long enough to obtain an orbit suitable for tracking purposes. Telescopes operating in survey mode, however, randomly observe objects that pass through their field of view. Typically, these short-arc observation are inadequate to obtain detailed orbits, but can be used to estimate approximate circular orbit elements (semimajor axis, inclination, and ascending node). From this information, it should be possible to make statistical inferences about the orbital distributions of the GEO population bright enough to be observed by the system. The Michigan Orbital Debris Survey Telescope (MODEST) has been making such statistical surveys of the GEO region for four years. During that time, the telescope has made enough observations in enough areas of the GEO belt to have had nearly complete coverage. That means that almost all objects in all possible orbits in the GEO and near- GEO region had a non-zero chance of being observed. Some regions (such as those near zero inclination) have had good coverage, while others are poorly covered. Nevertheless, it is possible to remove these statistical biases and reconstruct the orbit populations within the limits of sampling error. In this paper, these statistical techniques and assumptions are described, and the techniques are applied to the current MODEST data set to arrive at our best estimate of the GEO orbit population distribution