Computed Analysis of Three-Dimensional Cone-Beam Computed Tomography Angiography for Determination of Tumor-Feeding Vessels During Chemoembolization of Liver Tumor: A Pilot Study

The purpose of this study was to evaluate computed analysis of three-dimensional (3D) cone-beam computed tomography angiography (CTA) of the liver for determination of subsegmental tumor-feeding vessels (FVs). Eighteen consecutive patients underwent transarterial chemoembolization (TACE) from January to October 2008 for 25 liver tumors (15 hepatocellular carcinomas [HCCs] and 10 neuroendocrine metastases). Anteroposterior projection angiogram (two-dimensional [2D]) and 3D cone-beam CTA images were acquired by injection of the common hepatic artery. Retrospectively, FVs were independently identified by three radiology technologists using a software package (S) that automatically determines FVs by analysis of 3D images. Subsequently, three interventional radiologists (IRs) independently identified FVs by reviewing the 2D images followed by examination of the 3D images. Finally, the “ground truth” for the number and location of FVs was obtained by consensus among the IRs, who were allowed to use any imaging―including 2D, 3D, and all oblique or selective angiograms―for such determination. Sensitivities, durations, and degrees of agreement for review of 2D, 3D, and S results were evaluated. Sensitivity of 3D (73%) was higher than 2D (64%) images for identification of FVs (P = 0.036). The sensitivity of S (93%) was higher than 2D (P = 0.02) and 3D (P = 0.005) imaging. The duration for review of 3D imaging was longer than that for 2D imaging (187 vs. 94 s, P = 0.0001) or for S (135 s, P = 0.0001). The degree of agreement between the IRs using 2D and 3D imaging were 54% and 62%, respectively, whereas it was 82% between the three radiology technologists using S. These preliminary data show that computed determination of FVs is both accurate and sensitive

Submicroscopic Deletions at 13q32.1 Cause Congenital Microcoria.

International audienceCongenital microcoria (MCOR) is a rare autosomal-dominant disorder characterized by inability of the iris to dilate owing to absence of dilator pupillae muscle. So far, a dozen MCOR-affected families have been reported worldwide. By using whole-genome oligonucleotide array CGH, we have identified deletions at 13q32.1 segregating with MCOR in six families originating from France, Japan, and Mexico. Breakpoint sequence analyses showed nonrecurrent deletions in 5/6 families. The deletions varied from 35 kbp to 80 kbp in size, but invariably encompassed or interrupted only two genes: TGDS encoding the TDP-glucose 4,6-dehydratase and GPR180 encoding the G protein-coupled receptor 180, also known as intimal thickness-related receptor (ITR). Unlike TGDS which has no known function in muscle cells, GPR180 is involved in the regulation of smooth muscle cell growth. The identification of a null GPR180 mutation segregating over two generations with iridocorneal angle dysgenesis, which can be regarded as a MCOR endophenotype, is consistent with the view that deletions of this gene, with or without the loss of elements regulating the expression of neighboring genes, are the cause of MCOR

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH)

Relations phylogénétiques de souches cyanobactériennes non axéniques sur base de l'analyse du RNA ribosomique 16S

In order to determine the nearly complete 16S rRNA gene sequences of cyanobacteria originating from nonaxenic cultures, a cyanobacterium-specific oligonucleotide probe was developed to distinguish polymerase chain reaction (PCR) products of the cyanobacterial rRNA operons from those resulting from amplification of contaminating bacteria. Using this screening method the 16S rRNA genes of four nonaxenic filamentous cyanobacterial strains belonging to the genera Leptolyngbya and OscitIatoria were cloned and sequenced. For the genus Leptolyngbya, the 16S rRNA sequence of the axenic strain PCC 73110 was also determined. Phylogenetic trees were constructed based on complete and partial sequences. The results show that the strains Leptolyngbya Jbveolarum Kom~rek 1964/112, Leptolyngbya sp. VRUC 135 Albertano t985/1, and LeptoIyngbya boryanum PCC 73110 belong to the same cluster. Strain Oscillatoria cf. corallinae SAG 8.92, which contains the rare photosynthetic pigment CUphycoerythrin, is not closely related to other CUphycoerythrin- containing cyanobacteria. Oscillatoria agardhii CYA 18, which is a representative of planktonic Oscillatoria species that form toxic blooms in Norwegian inland waters, has no close relatives in the tree

Phylogenetic study of cyanobacteria on the basis of 1S ribosomal RNA sequences

In this study, the 16S rRNA sequences of five filamentous cyanobacteria (Cyanophyceae) have been determined. These sequences were used to construct, by a distance matrix method, a tree topology to depict the phylogenetic relationships among cyanobacteria

Evolution of green plants and their relationship with other photosynthetic eukaryotes as deduced from 5S ribosomal RNA sequences

The nucleotide sequence of cytoplasmic 5S ribosomal RNAs from three gymnosperms, Pinus contorta, Taxus baccata and Juniperus media and from one fern, Pteridium aquilinum, have been determined. These sequences were aligned with all hitherto known cytoplasmic 5S ribosomal RNA sequences of photosynthetic eukaryotes. A dendrogram based on that set of sequences was constructed by a distance matrix method and the resulting tree compared with established views concerning plant and algal evolution. The following monophyletic groups of photosynthetic eukaryotes are recognizable: the Rhodophyta, a group consisting of Phaeophyta, Bacillariophyta and Chrysophyta, and the green plants, the latter comprising green algae, Bryophyta, Pteridophyta and Spermatophyta. According to our 5S ribosomal RNA tree, green plants may have originated from some type of a green flagellated organism such as Chlamydomonas. The land plants seem to have originated from some form of charophyte such as Nitella. 5S ribosomal RNA seems to be less appropriate to estimate dissimilarities between species which have diverged relatively recently, like the angiosperms. Therefore, a precise evolutionary process is difficult to reconstruct for members of this group

Primary and secondary structure of the 18 S ribosomal RNA of the insect species Tenebrio molitor

AbstractThe sequence of the 18 S rRNA of Tenebrio molitor is reported. A detailed secondary structure model for eukaryotic small subunit rRNAs is proposed. The model comprises 48 universal helices that eukaryotic and prokaryotic small subunit rRNAs have in common, plus a number of helices in areas of variable secondary structure. For the central area of the model, an alternative structure is possible, applicable only to eukaryotic small subunit rRNAs. Possibly, small subunit rRNA switched to this alternative conformation after the eukaryotic branch had been established in evolution. Another possibility is that the two conformers represent a dynamic structural switch functioning during the translational activity of the eukaryotic ribosome

Evolutionary relationships among heterokont algae (the autotrophic stramenopiles) based on combined analyses of small and large subunit ribosomal RNA

In order to study the phylogenetic relationships within the stramenopiles, and particularly among the heterokont algae, we have determined complete or nearly complete large-subunit ribosomal RNA sequences for different species of raphidophytes, phaeophytes, xanthophytes, chrysophytes, synurophytes and pinguiophytes. With the small- and large-subunit ribosomal RNA sequences of representatives for nearly all known groups of heterokont algae, phylogenetic trees were constructed from a concatenated alignment of both ribosomal RNAs, including more than 5,000 positions. By using different tree construction methods, inferred phylogenies showed phaeophytes and xanthophytes as sister taxa, as well as the pelagophytes and dictyochophytes, and the chrysophytes/synurophytes and eustigmatophytes. All these relationships are highly supported by bootstrap analysis. However, apart from these sister group relationships, very few other internodes are well resolved and most groups of heterokont algae seem to have diverged within a relatively short time frame