2,939 research outputs found
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Recommended from our members
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM
Pathophysiology, diagnosis, and treatment of spinal meningoceles and arachnoid cysts
Though the nomenclature regarding spinal arachnoid cysts and meningoceles is confusing and sometimes overlapping, spinal arachnoid cysts and meningoceles are distinct entities with different presentations and etiologies. Meningoceles are usually congenital lesions discovered at infancy with a high incidence of associated anomalies. Spinal arachnoid cysts are most often asymptomatic but can cause nerve root and/or cord compression. We review the presentation, pathophysiology, and management of these lesions
Correlation of pre-earthquake electromagnetic signals with laboratory and field rock experiments
Analysis of the 2007 <i>M</i>5.4 Alum Rock earthquake near San José California showed that magnetic pulsations were present in large numbers and with significant amplitudes during the 2 week period leading up the event. These pulsations were 1–30 s in duration, had unusual polarities (many with only positive or only negative polarities versus both polarities), and were different than other pulsations observed over 2 years of data in that the pulse sequence was sustained over a 2 week period prior to the quake, and then disappeared shortly after the quake. A search for the underlying physics process that might explain these pulses was was undertaken, and one theory (Freund, 2002) demonstrated that charge carriers were released when various types of rocks were stressed in a laboratory environment. It was also significant that the observed charge carrier generation was transient, and resulted in pulsating current patterns. In an attempt to determine if this phenomenon occurred outside of the laboratory environment, the authors scaled up the physics experiment from a relatively small rock sample in a dry laboratory setting, to a large 7 metric tonne boulder comprised of Yosemite granite. This boulder was located in a natural, humid (above ground) setting at Bass Lake, Ca. The boulder was instrumented with two Zonge Engineering, Model ANT4 induction type magnetometers, two Trifield Air Ion Counters, a surface charge detector, a geophone, a Bruker Model EM27 Fourier Transform Infra Red (FTIR) spectrometer with Sterling cycle cooler, and various temperature sensors. The boulder was stressed over about 8 h using expanding concrete (Bustar<sup>tm</sup>), until it fractured into three major pieces. The recorded data showed surface charge build up, magnetic pulsations, impulsive air conductivity changes, and acoustical cues starting about 5 h before the boulder actually broke. These magnetic and air conductivity pulse signatures resembled both the laboratory rock stressing results and the 30 October 2007 <i>M</i>5.4 Alum Rock earthquake field data. <br><br> The second part of this paper examined other California earthquakes, prior to the Alum Rock earthquake, to see if magnetic pulsations were also present prior to those events. A search for field examples of medium earthquakes was performed to identify earthquakes where functioning magnetometers were present within 20 km, the expected detection range of the magnetometers. Two earthquakes identified in the search included the 12 August 1998 <i>M</i>5.1 San Juan Bautista (Hollister Ca.) earthquake and the 28 September 2004 <i>M</i>6.0 Parkfield Ca. earthquake. Both of these data sets were recorded using EMI Corp. Model BF4 induction magnetometers, installed in equipment owned and operated by UC Berkeley. Unfortunately, no air conductivity or IR data were available for these earthquake examples. This new analysis of old data used the raw time series data (40 samples per s), and examined the data for short duration pulsations that exceeded the normal background noise levels at each site, similar to the technique used at Alum Rock. Analysis of Hollister magnetometer, positioned 2 km from the epicenter, showed a significant increase in magnetic pulsations above quiescient threshold levels several weeks prior, and especially 2 days prior to the quake. The pattern of positive and negative pulsations observed at Hollister, were similar, but not identical to Alum Rock in that the pattern of pulsations were interspersed with Pc 1 pulsation trains, and did not start 2 weeks prior to the quake, but rather 2 days prior. The Parkfield data (magnetometer positioned 19 km from the epicenter) showed much smaller pre-earthquake pulsations, but the area had significantly higher conductivity (which attenuates the signals). More interesting was the fact that significant pulsations occurred between the aftershock sequences of quakes as the crustal stress patterns were migrating. <br><br> Comparing laboratory, field experiments with a boulder, and earthquake events, striking similarities were noted in magnetic pulsations and air conductivity changes, as well as IR signals (where instrumented). More earthquake samples, taken with the appropriate detectors and within 10–15 km proximity to large (><i>M</i>5) earthquakes, are still needed to provide more evidence to understand the variability between earthquakes and various electromagnetic signals detected prior to large earthquakes
Radar detection of a localized 1.4 Hz pulsation in auroral plasma, simultaneous with pulsating optical emissions, during a substorm
Many pulsating phenomena are associated with the auroral substorm.
It has been considered that some of these phenomena involve kilometer-scale
Alfvén waves coupling the magnetosphere and ionosphere. Electric field
oscillations at the altitude of the ionosphere are a signature of
such wave activity that could distinguish it from other sources of
auroral particle precipitation, which may be simply tracers of magnetospheric
activity. Therefore, a ground based diagnostic of kilometer-scale
oscillating electric fields would be a valuable tool in the study
of pulsations and the auroral substorm. In this study we attempt to
develop such a tool in the Poker Flat incoherent scatter radar (PFISR).
The central result is a statistically significant detection of a 1.4 Hz
electric field oscillation associated with a similar oscillating
optical emission, during the recovery phase of a substorm. The optical
emissions also contain a bright, lower frequency (0.2 Hz) pulsation
that does not show up in the radar backscatter. The fact that higher
frequency oscillations are detected by the radar, whereas the bright,
lower frequency optical pulsation is not detected by the radar, serves
to strengthen a theoretical argument that the radar is sensitive to
oscillating electric fields, but not to oscillating particle precipitation.
Although it is difficult to make conclusions as to the physical mechanism,
we do not find evidence for a plane-wave-like Alfvén wave; the detected
structure is evident in only two of five adjacent beams. We emphasize
that this is a new application for ISR, and that corroborating results
are needed
Picturing protest: visuality, visibility and the public sphere (special issue introduction).
Aims and Scope: This special issue is concerned with how and why certain visual images picturing protest events
and social movements are rendered visible or invisible in the public sphere. ‘Picturing Protest’
responds to the growing interest in a new protest culture and new ways of ‘doing politics’,
ranging from Arab revolts to the Occupy Movement, the Indignados and anti-austerity protests
in Europe. Since 2011 these new activisms have gained momentum in media and scholarly
debates. Contemporary activisms are seen as powerfully tied in to the possibilities that social
media platforms and web 2.0 technologies offer to those involved in practices of dissent in
physical squares and streets as much as in virtual environments. Of special interest here is how
new forms of political participation and the practice of dissent go in tandem with the
widespread use of visual images and internet memes facilitated by technological devices with
documentation facilities (e.g., smartphones, tablets) and social network technologies (Bennett
and Segerberg 2012). Iconic images like the image of dying Neda, a 26-year-old Iranian woman
killed by a sniper bullet during a protest event, go viral in social media platforms and have the
power to galvanize the attention of global publics. Hence, this new protest culture demands for
a different approach in the study of how protest images are constituted, analysed, interpreted
and circulated in both old and new media environments.
Taken all together, the different contributions ask how and why activists, photojournalists,
citizen journalists and journalists use protest images, ranging from maps, posters, to amateur
and professional photographs, to communicate with a range of audiences within and beyond
nationally-defined public spheres. The contributors do so by employing theoretical tools and
methods that originate from within a variety of disciplines, including media and communication, political science, sociology, semiotics and art history. In pursuing their research, the contributors draw on a variety of political contexts, including Spain, Portugal, the
West Bank and the Gaza Strip, Greece, Germany, Italy, Austria and the UK. One of the key
aims of this special issue is to overcome the overemphasis on the intended symbolic meanings
of protest images (Philipps, 2011), by directing the analytical lens to issues of image production
and diffusion. It does so to show how certain visual images, and not others, end up circulating
in a range of traditional and new media environments
Plant demographic knowledge is biased towards short-term studies of temperate-region herbaceous perennials
Plant demography has a long history resulting in a large knowledge base. Comparative analysis of this information allows exploration of the drivers of demographic patterns globally and the study of life-history evolution. Studies aiming to generalise demographic patterns rely on data being derived from a representative sample. However, the data are likely to be taxonomically, geographically and methodologically biased. Matrix population models (MPMs) are widely-used in plant demography, so an assessment of publications using MPMs is a convenient way to assess the distribution of plant demographic knowledge using this modelling approach. We assessed bias in this knowledge using data from the COMPADRE Plant Matrix Database, containing MPMs for > 700 species. We show that tree species and tropical areas are under-represented, while herbaceous perennials and temperate areas are over-represented. There is a positive association between the number of studies per country and per capita GDP. Most studies have low spatiotemporal replication with 43% of studies conducted over three sites. This limited spatiotemporal coverage means existing data may not represent the environmental conditions the species experience. These biases and knowledge gaps inhibit theory development and limit current utility for identifying useful generalities for management decisions, such as typical responses to climate change. It is likely that similar biases extend to other demographic modelling tools such as integral projection models. We urge researchers to address these biases and close these knowledge gaps
Predicting Greater Prairie-Chicken Lek Site Suitability to Inform Conservation Actions
The demands of a growing human population dictates that expansion of energy infrastructure, roads, and other development frequently takes place in native rangelands. Particularly, transmission lines and roads commonly divide rural landscapes and increase fragmentation. This has direct and indirect consequences on native wildlife that can be mitigated through thoughtful planning and proactive approaches to identifying areas of high conservation priority. We used nine years (2003–2011) of Greater Prairie-Chicken (Tympanuchus cupido) lek locations totaling 870 unique leks sites in Kansas and seven geographic information system (GIS) layers describing land cover, topography, and anthropogenic structures to model habitat suitability across the state. The models obtained had low omission rates (\u3c0.18) and high area under the curve scores (AUC \u3e0.81), indicating high model performance and reliability of predicted habitat suitability for Greater Prairie-Chickens. We found that elevation was the most influential in predicting lek locations, contributing three times more predictive power than any other variable. However, models were improved by the addition of land cover and anthropogenic features (transmission lines, roads, and oil and gas structures). Overall, our analysis provides a hierarchal understanding of Greater Prairie-Chicken habitat suitability that is broadly based on geomorphological features followed by land cover suitability. We found that when land features and vegetation cover are suitable for Greater Prairie-Chickens, fragmentation by anthropogenic sources such as roadways and transmission lines are a concern. Therefore, it is our recommendation that future human development in Kansas avoid areas that our models identified as highly suitable for Greater Prairie-Chickens and focus development on land cover types that are of lower conservation concern
- …