TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Comparison of Dog Surveys and Fall Covey Surveys in Estimating Fall Population Trends of Northern Bobwhite

The use of fall covey surveys to monitor population trends for northern bobwhite (Colinus virginianus; hereafter bobwhite) have been widely used in bobwhite research. Estimates of relative abundance from this monitoring technique are often important in assessing population responses to management practices or annual variation. However, conducting covey call surveys is labor intensive and typically can only be conducted during a narrow time frame. The use of dogs as a research tool may offer an efficient alternative to monitor bobwhite population trends. While dogs have been used in research for many other gallinaceous species, their application for bobwhite has received minimal research. To compare traditional and novel (dog) methods for both relative population abundance and density estimation, we conducted covey call surveys (50 points) and dog transects (32 km) during the fall (Sep-Oct) season from 2012-2014 at Beaver River WMA, Beaver County, Oklahoma, USA. A total of 306 detections were observed through fall covey count surveys, while only 44 detections were observed through dog transect surveys. Fall covey surveys yielded indices of 1.45, 2.04, and 3.21 detections per point count during 2012, 2013, and 2014, respectively. Dog transects yielded 0.23, 0.34, and 0.67 detections per km during 2012, 2013, and 2014, respectively. A Pearson’s correlation coefficient of 0.996 indicated high correlation between indices estimated between both survey methods. However, the low sample size for detections during dog surveys precluded any analysis that would yield bobwhite density estimates. Our results indicate that dog transects can be a method for estimating abundance indices for bobwhite. However, if estimates of bobwhite densities are of interest, then use of dog transect surveys are not recommended as only under high quail densities or with high observer efforts do enough detections accumulate for robust density estimation unless large effort is expended

Greater Sage-Grouse Resource Selection Drives Reproductive Fitness Under a Conifer Removal Strategy

The link between individual variation in resource selection (e.g., functional response) and fitness creates a foundation for understanding wildlife-habitat relationships. Although many anthropogenic activities adversely affect these relationships, it is largely unknown whether projects implemented to benefit wildlife populations actually achieve this outcome. For sagebrush (Artemisia spp.) obligate species such as the greater sage-grouse (Centrocercus urophasianus; sage-grouse), expansion of juniper (Juniperus spp.) and pinyon-pine (Pinus spp.; conifers) woodlands into sagebrush ecosystems has been identified as a conservation threat. This threat is intensified when a sagebrush ecosystem is bounded by naturally unsuitable habitats. As such, federal, state, and private land managers have implemented landscape-level management to remove conifers on thousands of hectares of sagebrush habitat across the western United States. Despite the scale of contemporary conifer treatments, little was previously known whether sage-grouse will occupy these manipulated landscapes and whether occupancy has consequences on fitness components. To address these questions, we monitored nest and brood success rates for 96 radio-marked sage-grouse from 2012-2015 that inhabited conifer-dominated landscapes in the Box Elder Sage-grouse Management Area in Utah where mechanical conifer removal projects were completed. We then linked sage-grouse resource selection to individual nest (n = 95) and brood (n = 56) success by incorporating random-slope Resource Selection Functions as explanatory predictors in a logistic brood success model. Using the novel approach of random slope covariates, we demonstrated that sage-grouse selected for nest and brooding sites closer to conifer removal areas and that the probability of individual nest and brood success declined (β = − 0.10 and β = − 0.74, respectively) as sage-grouse females selected sites farther from conifer removal areas. Our research provided the first evidence that mechanical conifer removal treatments can increase suitable available breeding habitats for female sage-grouse and that individuals who occupied these areas experienced enhanced nest and brood success

Tropical coastal habitats as surrogates of fish community structure, grazing, and fisheries value

Habitat maps are frequently invoked as surrogates of biodiversity to aid the design of networks of marine reserves. Maps are used to maximize habitat heterogeneity in reserves because this is likely to maximize the number of species protected. However, the technique's efficacy is limited by intra-habitat variability in the species present and their abundances. Although communities are expected to vary among patches of the same habitat, this variability is poorly documented and rarely incorporated into reserve planning. To examine intra-habitat variability in coral-reef fishes, we generated a data set from eight tropical coastal habitats and six islands in the Bahamian archipelago using underwater visual censuses. Firstly, we provide further support for habitat heterogeneity as a surrogate of biodiversity as each predefined habitat type supported a distinct assemblage of fishes. Intrahabitat variability in fish community structure at scales of hundreds of kilometers (among islands) was significant in at least 75% of the habitats studied, depending on whether presence/absence, density, or biomass data were used. Intra-habitat variability was positively correlated with the mean number of species in that habitat when density and biomass data were used. Such relationships provide a proxy for the assessment of intra-habitat variability when detailed quantitative data are scarce. Intra-habitat variability was examined in more detail for one habitat (forereefs visually dominated by Montastraea corals). Variability in community structure among islands was driven by small, demersal families (e. g., territorial pomacentrid and labrid fishes). Finally, we examined the ecological and economic significance of intra-habitat variability in fish assemblages on Montastraea reefs by identifying how this variability affects the composition and abundances of fishes in different functional groups, the key ecosystem process of parrotfish grazing, and the ecosystem service of value of commercially important finfish. There were significant differences in a range of functional groups and grazing, but not fisheries value. Variability at the scale of tens of kilometers (among reefs around an island) was less than that among islands. Caribbean marine reserves should be replicated at scales of hundreds of kilometers, particularly for species-rich habitats, to capture important intra-habitat variability in community structure, function, and an ecosystem process

Taxonomy of asteroid families among the Jupiter Trojans: Comparison between spectroscopic data and the Sloan Digital Sky Survey colors

We present a comparative analysis of the spectral slope and color distributions of Jupiter Trojans, with particular attention to asteroid families. We use a sample of data from the Moving Object Catalogue of the Sloan Digital Sky Survey, together with spectra obtained from several surveys. A first sample of 349 observations, corresponding to 250 Trojan asteroids, were extracted from the Sloan Digital Sky Survey, and we also extracted from the literature a second sample of 91 spectra, corresponding to 71 Trojans. The spectral slopes were computed by means of a least-squares fit to a straight line of the fluxes obtained from the Sloan observations in the first sample, and of the rebinned spectra in the second sample. In both cases the reflectance fluxes/spectra were renormalized to 1 at 6230 $\textrm{\AA}$. We found that the distribution of spectral slopes among Trojan asteroids shows a bimodality. About 2/3 of the objects have reddish slopes compatible with D-type asteroids, while the remaining bodies show less reddish colors compatible with the P-type and C-type classifications. The members of asteroid families also show a bimodal distribution with a very slight predominance of D-type asteroids, but the background is clearly dominated by the D-types. The L4 and L5 swarms show different distributions of spectral slopes, and bimodality is only observed in L4. These differences can be attributed to the asteroid families since the backgraound asteroids show the same slope distribtuions in both swarms. The analysis of individual families indicates that the families in L5 are taxonomically homogeneous, but in L4 they show a mixture of taxonomic types. We discuss a few scenarios that might help to interpret these results.Comment: 20 pages, 15 figures, 2 table

Decision for reconstructive interventions of the upper limb in individuals with tetraplegia: the effect of treatment characteristics

Objective: To determine the effect of treatment characteristics on the\ud decision for reconstructive interventions for the upper extremities (UE) in\ud subjects with tetraplegia. - \ud Setting: Seven specialized spinal cord injury centres in the Netherlands. - \ud Method: Treatment characteristics for UE reconstructive interventions were\ud determined. Conjoint analysis (CA) was used to determine the contribution\ud and the relative importance of the treatment characteristics on the decision\ud for therapy. Therefore, a number of different treatment scenarios using these\ud characteristics were established. Different pairs of scenarios were presented\ud to subjects who were asked to choose the preferred scenario of each set. - \ud Results: forty nine subjects with tetraplegia with a stable C5, C6 or C7\ud lesion were selected. All treatment characteristics significantly influenced\ud the choice for treatment. Relative importance of treatment characteristics\ud were: intervention type (surgery or surgery with FES implant) 13%, number\ud of operations 15%, in patient rehabilitation period 22%, ambulant\ud rehabilitation period 9%, complication rate 15%, improvement of elbow\ud function 10%, improvement of hand function 15%. In deciding for therapy\ud 40% of the subjects focused on one characteristic. - \ud Conclusion: CA is applicable in Spinal Cord Injury medicine to study the\ud effect of health outcomes and non-health outcomes on the decision for\ud treatment. Non-health outcomes which relate to the intensity of treatment\ud are equally important or even more important than functional outcome in the\ud decision for reconstructive UE surgery in subjects with tetraplegia

Does the presence of oil and gas infrastructure potentially increase risk of harvest in northern bobwhite?

Beyond organisms experiencing direct impacts (mortality) from the presence of anthropogenic features, interactive relationships may exacerbate the effects of anthropogenic disturbance within the context of these features. For example, mortality risk may be affected by the road infrastructure associated with energy development by influencing space use of predators including human hunters. To assess these relationships, we conducted research on northern bobwhite Colinus virginianusacross a hunted and non-hunted area of Beaver River Wildlife Management Area, Oklahoma, using radiotelemetry from 2012–2015. We found that bobwhite mortality risk decreased as the distance from primary roads (m) increased across weeks (hazard ratio [HR] = 1.008, 95% confidence interval [CI] = 1.0003 to 1.0013). The interaction between unit (hunted and non-hunted) and distance from primary roads was not significant (HR = 1.00, 95% CI = 0.999 to 1.001) indicating that hunting pressure was not a likely explanation for the observed decrease in survival related to primary roads. Bobwhite on the hunted unit avoided exposed soil/sparse vegetation ( = -0.01, CI = -0.02 to -0.002) and bare ground ( =-0.01, CI =-0.02 to -0.002) more than bobwhite on the non-hunted unit, however these were weak relationships. No other differences in bobwhite space use were detected related to hunting. Though we were limited to estimating theoretical rather than empirical amounts of hunting pressure during our study, we were unable to detect any negative compounding effects of anthropogenic development and hunting pressure on bobwhite ecology during the hunting season

Campaigning and Contestation:Comments on politicians’ Facebook pages during the 2011 Danish general election campaign

This article is a critical study of the Facebook pages of politicians as public spheres using Dahlberg’s notion of contestation. A method is implemented inspired by qualitative content analysis and including focus groups in order to study citizen comments on eight main political candidates’ Facebook pages during the 2011 Danish election campaign. An analytical framework is presented that conceptualizes the particular platform as a dinner party, with a dinner table, a host, and the invited guests. The dinner party exhibits the interplay between these elements and how they limit the option of contesting the dominating discourse in favor of a supportive marketing logic

WISE/NEOWISE Observations of the Hilda Population: Preliminary Results

We present the preliminary analysis of 1023 known asteroids in the Hilda region of the Solar System observed by the NEOWISE component of the Wide-field Infrared Survey Explorer (WISE). The sizes of the Hildas observed range from $\sim 3 - 200$km. We find no size - albedo dependency as reported by other projects. The albedos of our sample are low, with a weighted mean value $p_V = 0.055\pm0.018$, for all sizes sampled by the NEOWISE survey. We observed a significant fraction of the objects in the two known collisional families in the Hilda population. It is found that the Hilda collisional family is brighter, with weighted mean albedo of $p_V = 0.061\pm0.011$, than the general population and dominated by D-type asteroids, while the Schubart collisional family is darker, with weighted mean albedo of ($p_V = 0.039\pm0.013$). Using the reflected sunlight in the two shortest WISE bandpasses we are able to derive a method for taxonomic classification of $\sim 10$ of the Hildas detected in the NEOWISE survey. For the Hildas with diameter larger than 30km there are $67^{+7}_{-15}$ D-type asteroids and $26^{+17}_{-5}$ C-/P-type asteroids (with the majority of these being P-types).Comment: Accepted for publication in Astrophysical Journal. Electronic table to be published on the publishers websit