The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Disseny d'un plató chroma i desenvolupament d'activitats audiovisuals associades

Català: Aquest treball de fi de màster fa un recorregut per el currículum de diferents matèries de tots els nivells de l'etapa de secundaria, l'ESO i Batxillerat, proposant tot un conjunt d'activitats d'aprenentatge utilitzant la tècnica audiovisual chroma com eix vertebrador del disseny i desenvolupament de la pròpia activitat. El treball marca tot un seguit d'objectius, com són: • Dissenyar activitats d'aprenentatge audiovisuals utilitzant un plató i tècnica chroma i eines multimèdia. • Dissenyar i construir un plató chroma. Proposar un disseny òptim per tal de minimitzar l'impacte del cost econòmic. • Demostrar que la tècnica audiovisual chroma pot ser un instrument molt positiu per desenvolupar activitats d'aprenentatge que ajudin al procés d'aprenentatge dels alumnes, a treballar competències i assolir objectius formatius marcats per la programació. • Demostrar que es poden dissenyar activitats d'aprenentatge interdisciplinàries de manera transversal a qualsevol dels nivells de l'etapa de secundaria, ESO i Batxillerat, mitjançant recursos audiovisuals, com un plató chroma. • Demostrar que les activitats proposades compleixen i ajuden a treballar l'atenció a la diversitat i la inclusió d'alumnes NEE. Les activitats proposades per treballar amb el plató chroma, són: • 1r. ESO - Construcció d'un plató chroma • 2n. ESO - Escenificació d'una situació històrica • 3r. ESO - Mario Bros, salt de tanques. • 4t. ESO - Tècniques de post-producció audiovisual • 1r. Batxillerat - TV escolar • 2n. Batxillerat – Situacions comunicatives Cadascuna d'aquestes activitats proposades detallen la contextualització, detall i justificació, dinàmica de grup, temporització, competències i objectius formatius, materials, atenció a la diversitat i inclusió d'alumnes NEE, avaluació i metodologia d'aprenentatge. Referent al plató chroma, el treball descriu el disseny proposat, materials i avaluació econòmica. I posteriorment es detallen les etapes més rellevants de la construcció de l'estructura. I per últim, el treball conclou que s'han assolit tots els objectius marcats i que ha a nivell personal ha estat un treball molt gratificant

HilA-like regulators in Escherichia coli pathotypes: the YgeH protein from the enteroaggregative strain 042

Background The HilA protein is the master regulator of the Salmonella pathogenicity island 1 (SPI1). EilA and YgeH proteins show a moderate similarity to HilA and are encoded in pathogenicity islands from several E. coli strains, both pathogenic and non-pathogenic. In the present work we characterize the YgeH protein from the enteroaggregative E. coli strain 042 (locus tag EC042_3050). Results We show that both E. coli 042 YgeH and EilA proteins are able to functionally replace HilA in Salmonella. Interestingly, this is not the rule for all YgeH proteins: the YgeH protein from the enterohaemorragic E. coli strain O157 appears to be non-functional. ygeH expression is not influenced by growth osmolarity or temperature, and moderately increases in cells entering the stationary phase. H-NS represses ygeH expression under all growth conditions tested, and binds with specificity to the ygeH promoter region. As expected, expression of ETT2 (Escherichia coli type 3 secretion system 2) genes requires YgeH: ETT2 operons are downregulated in a ygeH mutant. Accordingly, since H-NS represses ygeH expression, ETT2 expression is significantly increased in an hns mutant. Conclusion E. coli 042 YgeH protein is functional and able to replace HilA in Salmonella. ETT2 gene expression requires YgeH activity which, in turn, is subjected to H-NS silencing

Temperature Dependent Control of the R27 Conjugative Plasmid Genes

Conjugation of R27 plasmid is thermoregulated, being promoted at 25°C and repressed at 37°C. Previous studies identified plasmid-encoded regulators, HtdA, TrhR and TrhY, that control expression of conjugation-related genes (tra). Moreover, the nucleoid-associated protein H-NS represses conjugation at non-permissive temperature. A transcriptomic approach has been used to characterize the effect of temperature on the expression of the 205 R27 genes. Many of the 35 tra genes, directly involved in plasmid-conjugation, were upregulated at 25°C. However, the majority of the non-tra R27 genes many of them with unknown function were more actively expressed at 37°C. The role of HtdA, a regulator that causes repression of the R27 conjugation by counteracting TrhR/TrhY mediated activation of tra genes, has been investigated. Most of the R27 genes are severely derepressed at 25°C in an htdA mutant, suggesting that HtdA is involved also in the repression of R27 genes other than the tra genes. Interestingly, the effect of htdA mutation was abolished at non-permissive temperature, indicating that the HtdA-TrhR/TrhY regulatory circuit mediates the environmental regulation of R27 gene expression. The role of H-NS in the proposed model is discussed

An improved and versatile methodology to quantify biofilms formed on solid surfaces and exposed to the air-liquid interphase

To study pellicle formation, a new method has been developed to quantify biofilm formed on solid surfaces and exposed to air-liquid interphase. It is a versatile system since different adherent material surfaces might be tested. The methodology is a robust and reproducible approach to quantify biofilm

Responses of hyperthermophilic crenarchaea to UV irradiation

The transcriptional response to UV irradiation was analyzed in two related crenarchaea, Sulfolobus solfataricus and Sulfolobus acidocaldarius, showing a clear response to DNA damage but no increase in the expression of DNA repair genes

Growth phase-dependent control of R27 conjugation is mediated by the interplay between the plasmidencoded regulatory circuit TrhR/TrhY-HtdA and the cAMP regulon

Plasmids of the incompatibility group HI1 (IncHI1) have been isolated from several Gram-negative pathogens and are associated with the spread of multidrug resistance. Their conjugation is tightly regulated and it is inhibited at temperatures higher than 30ºC, indicating that conjugation occurs outside warm-blooded hosts. Using R27, the prototype of IncHI1 plasmids, we report that plasmid transfer efficiency in E. coli strongly depends on the physiological state of the donor cells. Conjugation frequency is high when cells are actively growing, dropping sharply when cells enter the stationary phase of growth. Accordingly, our transcriptomic assays show significant downregulation of numerous R27 genes during the stationary phase, including several tra (transfer) genes. Growth phase-dependent regulation of tra genes transcription is independent of H-NS, a silencer of horizontal gene transfer, and ppGpp and RpoS, regulators of the stationary phase, but highly dependent on the plasmid-encoded regulatory circuit TrhR/TrhY-HtdA. The metabolic sensor cAMP, whose synthesis is chromosomally encoded, is also involved in the growth phase regulation of R27 conjugation by modulating htdA expression. Our data suggest that the involvement of regulators encoded by both chromosome and plasmid are required for efficient physiological control of IncHI1 plasmid conjugation

Crosstalk between bacterial conjugationa and motility is mediated by plasmid-borne regulators

Plasmid conjugation is a major horizontal gene transfer mechanism. The acquisition of a plasmid may cause a perturbation of the cell functions in addition to provide advantageous properties for the recipient cell, such as the gaining of antibiotic resistances. The interplay between plasmid and chromosomal functions has been studied using the IncHI1 plasmid R27. Plasmids of the incompatibility group HI1, isolated from several Gram-negative pathogens, are associated with the spread of multidrug resistance. Their conjugation is tightly regulated by temperature, being repressed at temperatures within the host (37 ºC). In this report, we described that at permissive temperature, when conjugation of plasmid R27 is prompted, a reduction in the motility of the cells is observed. This reduction is mediated by the plasmid-encoded regulators TrhR/TrhY, which together with HtdA form a plasmid -borne regulatory circuit controlling R27 conjugation. TrhR/TrhY, required to induce R27 conjugation, are responsible of the downregulation of the flagella synthesis and the consequent decrease in motility. TrhR/TrhYrepress, direct or indirectly, the expression of the specific flagellar sigma subunit FliA and, consequently, the expression of all genes located bellow in the flagellar expression cascade

Essential residues in the H-NS binding site of Hha, a co-regulator of horizontally acquired genes in Enterobacteria

Proteins of the Hha/YmoA family co-regulate with H-NS the expression of horizontally acquired genes in Enterobacteria. Systematic mutations of conserved acidic residues in Hha have allowed the identification of D48 as an essential residue for H-NS binding and the involvement of E25. Mutations of these residues resulted in deregulation of sensitive genes in vivo. D48 is only partially solvent accessible, yet it defines the functional binding interface between Hha and H-NS confirming that Hha has to undergo a conformational change to bind H-NS. Exposed acidic residues, such as E25, may electrostatically facilitate and direct the approach of Hha to the positively charged region of H-NS enabling the formation of the final complex when D48 becomes accessible by a conformational change of Hha