Biomimetic hydroxyapatite nanocrystals are an active carrier for Salmonella bacteriophages

open access articlePurpose: The use of bacteriophages represents a valid alternative to conventional antimicrobial treatments, overcoming the widespread bacterial antibiotic resistance phenomenon. In this work, we evaluated whether biomimetic hydroxyapatite (HA) nanocrystals are able to enhance some properties of bacteriophages. The final goal of this study was to demonstrate that biomimetic HA nanocrystals can be used for bacteriophage delivery in the context of bacterial infections, and contribute – at the same time – to enhance some of the biological properties of the same bacteriophages such as stability, preservation, antimicrobial activity, and so on. Materials and methods: Phage isolation and characterization were carried out by using Mitomycin C and following double-layer agar technique. The biomimetic HA water suspension was synthesized in order to obtain nanocrystals with plate-like morphology and nanometric dimensions. The interaction of phages with the HA was investigated by dynamic light scattering and Zeta potential analyses. The cytotoxicity and intracellular killing activities of the phage–HA complex were evaluated in human hepatocellular carcinoma HepG2 cells. The bacterial inhibition capacity of the complex was assessed on chicken minced meat samples infected with Salmonella Rissen. Results: Our data highlighted that the biomimetic HA nanocrystal–bacteriophage complex was more stable and more effective than phages alone in all tested experimental conditions. Conclusion: Our results evidenced the important contribution of biomimetic HA nanocrystals: they act as an excellent carrier for bacteriophage delivery and enhance its biological characteristics. This study confirmed the significant role of the mineral HA when it is complexed with biological entities like bacteriophages, as it has been shown for molecules such as lactoferrin

Eucalyptus cinerea and E. nicholii by-Products as Source of Bioactive Compounds for Agricultural Applications

The cultivation of different species of Eucalyptus has recently expanded in Liguria (Italy) due to the growing demand of the North European floricultural market. Eucalyptus tree branches are cut and selected for their quality, resulting in large amounts of waste biomass to be disposed of. The aim of our study was to evaluate the phytotoxic and antimicrobial activities of essential oils (EOs) from pruning wastes of E. cinerea (EC) and E. nicholii (EN), for potential applications in agriculture. Phytochemical analyses showed eucalyptol (1,8-cineole) as the major component in both EOs, but the EO yield of EN was higher than that of EC, in agreement with a significantly higher oil gland density on EN leaves. EOs from both species showed phytotoxicity on both weeds tested, but no significant inhibition on horticultural crop seed germination, except for Raphanus sativus. The EO from EC showed the strongest antibacterial activity, while the EO from EN showed the strongest antifungal activity. Concluding, EOs from Eucalyptus pruning may be used as possible alternatives to synthetic herbicides and pesticides, acting as antimicrobial and antifungal agents, thus representing a safe strategy for crop management programs

The Union is Strength: The Synergic Action of Long Fatty Acids and a Bacteriophage against Xanthomonas campestris Biofilm

Xanthomonas campestris pv. campestris is known as the causative agent of black rot disease, which attacks mainly crucifers, severely lowering their global productivity. One of the main virulence factors of this pathogen is its capability to penetrate and form biofilm structures in the xylem vessels. The discovery of novel approaches to crop disease management is urgent and a possible treatment could be aimed at the eradication of biofilm, although anti-biofilm approaches in agricultural microbiology are still rare. Considering the multifactorial nature of biofilm, an effective approach against Xanthomonas campestris implies the use of a multi-targeted or combinatorial strategy. In this paper, an anti-biofilm strategy based on the use of fatty acids and the bacteriophage (Xccφ1)-hydroxyapatite complex was optimized against Xanthomonas campestris mature biofilm. The synergic action of these elements was demonstrated and the efficient removal of Xanthomonas campestris mature biofilm was also proven in a flow cell system, making the proposed approach an effective solution to enhance plant survival in Xanthomonas campestris infections. Moreover, the molecular mechanisms responsible for the efficacy of the proposed treatment were explored

Bacteriophage engineering for industrial application

The use of bacteriophages for controlling plant bacterial diseases is an increasing research field with great potential. Public concerns about environmental abuse of pesticides are increasing the popularity of organic production, that contributed to the growth of biological control agent studies, and their use in plant disease management. However, the efficient use of biocontrol agents requires good understanding of their biological characteristics and efficacy. Furthermore, phage therapy is an attractive option to prevent and control biofilm related infections, supposed to contribute to an improved success of such an integrated bacterial spot control strategy and to reduce the use of conventional pesticides, which is beneficial to the environment, and human and animal health. Phage therapy is carried out by countless positive aspects that facilitate the battle against bacterial infections. The study of these processes has provided important scientific background about new intermediates, unusual nanoparticles, different gene organizations and special regulatory mechanisms, thus expanding older disciplines such as biochemistry, genetics and microbiology. Several bacterial strains develop into resistant from different types of antibiotics; it is called multiple resistance antimicrobials if the resistance is for four or more different classes of antimicrobials. In this contest, my PhD project aimed to the engineer a lytic bacteriophage in order to overcome the antibiotic resistance problems. Moreover, based to the biofilm problem the idea is to use an anti-biofilm molecule in synergy with the bacteriophage. For this reason, my project was focused on the characterization of a bacteriophage, an anti-biofilm molecule, and a carrier that help the complexation. The first part of my PhD was dedicated on the isolation of Xanthomonas campestris pv. campestris-specific bacteriophage from soil. It was further characterized by studying its plaque morphology, host range, pH stability, and morphology. The second part of my project was focused on the detection of an antibiofilm molecule and its possible application in combination with the phage carried by the hydroxyapatite. The last part was on the study of the metabolic changed of the biofilm carried out by the phage and the anti-biofilm molecule. All these results helped for better understand the best way to engineer the phage for translate all the result carried out to other bacterial infection

Phage therapy: a crosslink between human and plants bacterial infection.

Bacteria are under constant attack by bacteriophages (phages), the most abundant life forms in the biosphere. This work describes how the phage therapy is an efficient way to contrast the bacterial infection regardless the host. Here we describe the activity of phage in both plant and chicken meat. All the experiment carried out are with phage complex whit the hydroxyapatite, since many years, hydroxyapatite is being explored as vehicle for drug targeting, transfection, bone scaffolds and implant coating materials and, for these reasons we evaluated the effect of this mineral for the bacteriophage therapy. At first, we validated the antimicrobial activity of the phage and its possible direct administration into the plant xylem. We next performed both in vivo and in vitro experiments to assess the activity of the bacteriophage in association whit hydroxyapatite; seconds, we demonstrate that the hydroxyapatite/bacteriophage complex was able to reduce the bacterial load of Salmonella Rissen in previously infected minced meat, respect to bacteriophage or hydroxyapatite alone

Salmonella Rissen Φ1: a molecular switch

Introduction: Bacteria develop resistance against phages by losing the phage receptor or reducing its binding specificity or by a temporary change of phage receptor specificity. Here we describe the phage resistance mechanism adopted by S. Rissen which acts through a molecular switch. Material & Methods: Phage was isolated from the S. Rissen strain (RW) and used to select the phage resistant strain RRϕ1+. We evaluate both the differences in bacterial morphology and the genetic variations between the two strains by biochemical and comparative genomic analyses. Results: Biochemical analyses showed that the presence of the phage influences biofilm production, phage resistance and the switch of the O-antigen from smooth to rough, Genomic analysis showed that the sensitive and resistant strains differ by 10 genes. Only the phosphomannomutase_1 and 2 genes, involved in mannose synthesis pathway, showed different expression levels. The SNP of the two genes are located near HTs known to regulate phase variation. We used S rissen to see whether a character under strong selection pressure- such as phage resistance is repeatable. In four independent experiment phage resistance was acquired by the same molecular mechanism. Conclusion: S. rissen uses the same and evolutionary flexible tool (phase variation) to control several characters: biofilm production, phage resistance, and O-antigen structure

An Innovative Approach to Control H. pylori-Induced Persistent Inflammation and Colonization

Helicobacter pylori (H. pylori) is a Gram-negative bacterium which colonizes the human stomach. The ability of H. pylori to evade the host defense system and the emergence of antibiotic resistant strains result in bacteria persistence and chronic inflammation, which leads to both severe gastric and extra-gastric diseases. Consequently, innovative approaches able to overcome H. pylori clinical outcomes are needed. In this work, we develop a novel non-toxic therapy based on the synergistic action of H. pylori phage and lactoferrin adsorbed on hydroxyapatite nanoparticles, which effectively impairs bacteria colonization and minimizes the damage of the host pro-inflammatory response

Identification of a novel polymorphism in the 3’untraslated region of the interferon gamma gene as potential marker associate with bovine tuberculosis in water buffalo

Interferon gamma (IFNG) is a pro-inflammatory cytokine produced by different cells of the innate and adaptive immune system. It plays a critical role orchestrating the immune response towards many pathogens including virus and intracellular bacteria. Mycobacterium bovis, the causing agent of bovine tuberculosis (bTB), is an intracellular bacteria that is phagocytized by alveolar macrophages and stimulates production and secretion of IFNG. It has been demonstrated that polymorphisms in the Ifng gene affect the outcome of TB. For this reason, in this study we want to analyze the genetic variability in the Ifng gene and how the susceptibility to bovine tuberculosis in water buffalo (Bubalus bubalis) is influenced. To test our hypothesis, we have collected 184 blood samples from 5 different water buffalo herds in the Campania region (South Italy). Samples were first divided in cases (59 subjects) and controls (125 subjects) according to a previous study. We sequenced a fragment of 690 bp spanning the exon 4 of Ifng gene (NW_005783995.1) in 20 samples chosen randomly. Alignment analysis show a nucleotide transversion at the position g.4667G>A in the 3’ untraslated region (3’UTR). To verify if the g.4667G>A could have any potential regulatory effect on IFNG expression, we interrogated a software for prediction of microRNA (miR) binding site (http://www.targetscan.org/vert_71/). MicroRNA (miR) are short noncoding RNA that influence the gene expression targeting a seed sequence mostly located the 3’UTR of a specific gene. Thus, we found that our polymorphism belong to 5’ GGTTTTATCTCAGGGGCCAACTAGG 3’ that includes the seed sequence of miR-125b (seed sequence is underlined and the polymorphism g.4667G>A is highlighted in bold). This preliminary finding is a good starting point for extending the analysis of g.4667G>A to all 184 samples to verify if the polymorphism is associated with resistance to bovine tuberculosis in water buffalo. Moreover, functional in vitro studies will be performed to evaluate if the binding of miR-125b is influenced by the g.4667G>A in water buffalo

An innovative approach to control H. Pylori-induced persistent inflammation and colonization

Helicobacter pylori (H. pylori) is a Gram-negative bacterium which colonizes the human stomach. The ability of H. pylori to evade the host defense system and the emergence of antibiotic resistant strains result in bacteria persistence and chronic inflammation, which leads to both severe gastric and extra-gastric diseases. Consequently, innovative approaches able to overcome H. pylori clinical outcomes are needed. In this work, we develop a novel non-toxic therapy based on the synergistic action of H. pylori phage and lactoferrin adsorbed on hydroxyapatite nanoparticles, which effectively impairs bacteria colonization and minimizes the damage of the host pro-inflammatory response

Moringa oleifera Lam.: A Phytochemical and Pharmacological Overview

Moringa oleifera Lam. is a fast-growing and drought-resistant tree of the Moringaceae family. The tree is known with some common names: miracle, ben oil, drumstick, horseradish or simply moringa. The plant grows in a variety of environments including harsh conditions. The plant has a high content of phytonutrients, being used as natural integrators to cure malnutrition. Phytochemical studies of plant organs showed the plant as a rich source of primary and secondary metabolites belonging to different classes of organic compounds. Pharmacological studies confirmed the use of the plant to cure several diseases and to possess nutraceutical properties. This review is aimed to contribute to the knowledge of M. oleifera by providing its plant description, phytochemistry and pharmacology