Exponential speed of mixing for skew-products with singularities

Let $f: [0,1]\times [0,1] \setminus {1/2} \to [0,1]\times [0,1]$ be the $C^\infty$ endomorphism given by $$f(x,y)=(2x- [2x], y+ c/|x-1/2|- [y+ c/|x-1/2|]),$$ where $c$ is a positive real number. We prove that $f$ is topologically mixing and if $c>1/4$ then $f$ is mixing with respect to Lebesgue measure. Furthermore we prove that the speed of mixing is exponential.Comment: 23 pages, 3 figure

Cytocompatibility of Caffeic Acid-Silica Hybrid Materials on NIH-3T3 Fibroblast Cells

The hydroxycinnamoyl compound caffeic acid (CA), broadly occurring in plants, is receiving special attention in materials science thanks to its antioxidant, anti-inflammatory, and antimicrobial activities that make it promising for application use in various sectors. In this context, CA–based peptide biomaterials are recently developed as eco-friendly and multifunctional free radical scavengers useable in a wide range of consumer manufacture, ranging from cosmetics to household products, as well as clinical applications, including imaging, drug delivery, and disinfection. Furthermore, a water-soluble chitosan-caffeic acid conjugate, effective in delaying lipid oxidation, is also synthetized. Herein, exploiting sol-gel route versatility, CA/silica materials are synthetized. Hybrids, chemically characterized mainly through spectroscopic techniques, varied in their relative CA content, which represented 5%, 10%, 15%, or 20% of materials’ weight. The synthetized materials are able to elicit anti-radical properties. The CA amount appeared to be determinant in anti-radical activity, as well as in biocompatibility assessment. To this latter purpose, mouse embryonic fibroblast cell line NIH-3T3 cells are utilized and directly exposed to hybrid materials. Redox mitochondrial activity is evaluated by means of the MTT test, whose results are in accordance with the materials’ biocompatibility

Isolated Testicular Metastasis from Prostate Cancer

Prostatic adenocarcinoma is the most frequently diagnosed carcinoma in the male population; the most common sites of secondary lesions are nodes, bones, and lungs. We report the clinical case of a 58-year-old man presenting with a single metastasis in the left testis after a radical prostatectomy/lymphadenectomy for prostate cancer. CASE REPORT This clinical report focuses on a 58-year-old man with prostate cancer who developed an uncommon single metastasis in the left testis after radical surgery and adjuvant pelvic radiation therapy. CONCLUSIONS Prostate-specific antigen (PSA) levels are important in the follow-up of prostate cancer. At the same time, physical examination of all possible sites of metastasis and proper evaluation of all signs/symptoms are indispensable in the process of identifying recurrence and for the selection of patients undergoing adjuvant therapy

Hepatic Steatosis and Thyroid Function Tests in Overweight and Obese Children

Objectives. Associations between thyroid function and nonalcoholic fatty liver disease (NAFLD) are unknown in childhood. Thus, the aim of the present study was to investigate in 402 consecutive overweight/obese children the association between thyroid function tests and hepatic steatosis as well as metabolic variables. Methods. Hepatic steatosis was diagnosed by ultrasound after exclusion of infectious and metabolic disorders. Fasting serum samples were taken for determination of thyroid function (TSH, FT4, and FT3), along with alanine aminotransferase (ALT), lipid profile, glucose, insulin, and insulin resistance (IR). Results. Eighty-eight children (21.9%) had TSH above the normal range (>4.0 mIU/L). FT3 and FT4 were within the reference intervals in all subjects. Elevated TSH was associated with increased odds of having hepatic steatosis (OR 2.10 (95% CI, 1.22–3.60)), hepatic steatosis with elevated ALT (2.42 (95% CI, 1.29–4.51)), hypertriglyceridemia, elevated total cholesterol, and IR as well as metabolic syndrome (considered as a single clinical entity), after adjustment for age, gender, pubertal status, and body mass index-SD score (or waist circumference). Conclusions. In overweight/obese children, elevated TSH concentration is a significant predictor of hepatic steatosis and lipid and glucose dysmetabolism, independently of the degree of total and visceral obesity

Statistical properties of Lorenz like flows, recent developments and perspectives

We comment on mathematical results about the statistical behavior of Lorenz equations an its attractor, and more generally to the class of singular hyperbolic systems. The mathematical theory of such kind of systems turned out to be surprisingly difficult. It is remarkable that a rigorous proof of the existence of the Lorenz attractor was presented only around the year 2000 with a computer assisted proof together with an extension of the hyperbolic theory developed to encompass attractors robustly containing equilibria. We present some of the main results on the statisitcal behavior of such systems. We show that for attractors of three-dimensional flows, robust chaotic behavior is equivalent to the existence of certain hyperbolic structures, known as singular-hyperbolicity. These structures, in turn, are associated to the existence of physical measures: \emph{in low dimensions, robust chaotic behavior for flows ensures the existence of a physical measure}. We then give more details on recent results on the dynamics of singular-hyperbolic (Lorenz-like) attractors.Comment: 40 pages; 10 figures; Keywords: sensitive dependence on initial conditions, physical measure, singular-hyperbolicity, expansiveness, robust attractor, robust chaotic flow, positive Lyapunov exponent, large deviations, hitting and recurrence times. Minor typos corrected and precise acknowledgments of financial support added. To appear in Int J of Bif and Chaos in App Sciences and Engineerin

First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

An Italian survey on dietary habits and changes during the COVID-19 lockdown

The World Health Organization has declared the coronavirus outbreak a Public Health Emergency of International Concern; the outbreak has led to lockdowns in several parts of the world, and sudden changes in people’s lifestyles. This study explores the impact of the first coronavirus disease 2019 (COVID-19) pandemic period on dietary habits, lifestyle changes, and adherence to the Mediterranean diet among the Italian population, through an online questionnaire, conducted from April to May 2020, involving 1519 participants. The 14-point Mediterranean Diet Adherence Screener (MEDAS) highlighted a medium Mediterranean diet adherence in 73.5% of responders, which principally included the younger population, aged 18–30 years (p < 0.05). In regards to changes in eating habits, 33.5% of responders declared an influence of the pandemic period on nutritional practice. A decrease in alcohol consumption was reported by 81% of responders, while an increase in frozen food consumption was reported by 81.3% of responders. In addition, 58.8% reported positive weight modification (40.8%, +1–3 kg); physical activity reduction was reported for 70.5% of responders. Our study contributes toward amplifying the investigation on the dietary habits and changes of the Italian population during the COVID-19 lockdown, although the pandemic is ongoing. Similar studies should be performed around the world to understand how the emergency has impacted people’s habits

In vitro efficacy of alphacypermethrin on the buffalo louse Haematopinus tuberculatus (Burmeister, 1839).

In Italy buffalo farms adopted intensive breeding techniques, however the high density of animals in intensive breeding favours the diffusion of ectoparasites, such as louse. The aim of this study was to determine the in vitro efficacy of the insecticide alphacypermethrin (ACYP) against the buffalo louse, Haematopinus tuberculatus. The study was performed by using louse collected from animals in a commercial buffalo farm located in the Campania region of Southern Italy. Lice (adults and nymphs) were collected from highly infested buffaloes. The ACYP was diluted with physiological solution to different concentrations: 1.5%, 0.75%, 0.37%. A volume of 600 μl of the diluted sample was spread evenly over a filter paper held in the lower half of Petri dish. Ten adult lice and ten nymphs were placed on the top of each filter paper disc. The control groups were treated with physiological solution. Seven replicates were used for each concentration. The louse vitality was assessed at different time intervals: 1, 2, 4, 8, 10, 15, 20, 30, 40, 50, 60 minutes, after every 10 min until 240 min or at the louse death. After 240 min the louse vitality was examined each 60 min until 540 min. In vitro bioassays revealed that the lousicidal efficacy of ACYP improved as the concentration and the exposure time increased. The results of this in vitro study confirm that ACYP at 1.5% concentration can also be used in buffalo for the control of lice, as already in use in cattle. Further field trials will need to be conducted to confirm the safety, the dosage and the in vivo parasitological efficacy of this drug on buffaloes