Transposon-Based Reporter Marking Provides Functional Evidence for Intercellular Bridges in the Male Germline of Rabbits

K

Characterization of the Rabbit Neonatal Fc Receptor (FcRn) and Analyzing the Immunophenotype of the Transgenic Rabbits That Overexpresses FcRn

The neonatal Fc receptor (FcRn) regulates IgG and albumin homeostasis, mediates maternal IgG transport, takes an active role in phagocytosis, and delivers antigen for presentation. We have previously shown that overexpression of FcRn in transgenic mice significantly improves the humoral immune response. Because rabbits are an important source of polyclonal and monoclonal antibodies, adaptation of our FcRn overexpression technology in this species would bring significant advantages. We cloned the full length cDNA of the rabbit FcRn alpha-chain and found that it is similar to its orthologous analyzed so far. The rabbit FcRn - IgG contact residues are highly conserved, and based on this we predicted pH dependent interaction, which we confirmed by analyzing the pH dependent binding of FcRn to rabbit IgG using yolk sac lysates of rabbit fetuses by Western blot. Using immunohistochemistry, we detected strong FcRn staining in the endodermal cells of the rabbit yolk sac membrane, while the placental trophoblast cells and amnion showed no FcRn staining. Then, using BAC transgenesis we generated transgenic rabbits carrying and overexpressing a 110 kb rabbit genomic fragment encoding the FcRn. These transgenic rabbits – having one extra copy of the FcRn when hemizygous and two extra copies when homozygous - showed improved IgG protection and an augmented humoral immune response when immunized with a variety of different antigens. Our results in these transgenic rabbits demonstrate an increased immune response, similar to what we described in mice, indicating that FcRn overexpression brings significant advantages for the production of polyclonal and monoclonal antibodies

“Heat waves” experienced during larval life have species-specific consequences on life-history traits and sexual development in anuran amphibians

Extreme temperatures during heat waves can induce mass-mortality events, but can also exert sublethal negative effects by compromising life-history traits and derailing sexual development. Ectothermic animals may, however, also benefit from increased temperatures via enhanced physiological performance and the suppression of cold-adapted pathogens. Therefore, it is crucial to address how the intensity and timing of naturally occurring or human-induced heat waves affect life-history traits and sexual development in amphibians, to predict future effects of climate change and to minimise risks arising from the application of elevated temperature in disease mitigation. We raised agile frog (Rana dalmatina; Bonaparte, 1840) and common toad (Bufo bufo; Linnaeus, 1758) tadpoles at 19 °C and exposed them to a simulated heat wave of 28 or 30 °C for six days during one of three ontogenetic periods (early, mid or late larval development). In agile frogs, exposure to 30 °C during early larval development increased mortality. Regardless of timing, all heat-treatments delayed metamorphosis, and exposure to 30 °C decreased body mass at metamorphosis. Furthermore, exposure to 30 °C during any period and to 28 °C late in development caused female-to-male sex reversal, skewing sex ratios strongly towards males. In common toads, high temperature only slightly decreased survival and did not influence phenotypic sex ratio, while it reduced metamorph mass and length of larval development. Juvenile body mass measured two months after metamorphosis was not altered by temperature treatments in either species. Our results indicate that heat waves may have devastating effects on amphibian populations, and the severity of these negative consequences, and sensitivity can vary greatly between species and with the timing and intensity of heat. Finally, thermal treatments against cold-adapted pathogens have to be executed with caution, taking into account the thermo-sensitivity of the species and the life stage of animals to be treated.</p

Transposon-Based Reporter Marking Provides Functional Evidence for Intercellular Bridges in the Male Germline of Rabbits - Fig 5

<p>Venus expression in rabbit spermatozoa Representative, normalized Venus fluorophore expression in spermatozoa of # 4007 homozygous (A) and # 4004 hemizygous bucks (B) no expression in wild type littermate (C), viewed under specific excitation and dim bright light. A’, B’ and C’ shows the corresponding sperm under bright light.</p

Differential Venus expression in the SB-CAG-VENUS rabbit spermatozoa (FACS).

<p>Semen derived from a wild type (black), a hemizygous (# 4004, light gray) and a homozygous (# 4007, gray) buck.</p

The expression of Venus protein of testis from three SB transgenic homozygote mouse lines The somatic cells expressed Venus protein, but spermatocytes, spermatids and spermatozoa did not show Venus specific fluorescence.

<p>Testis sections of wild type mice remained Venus negative. A,B,C:#VL1;D,E,F:#VL3;G,H,I: #VL4; J,K,L:wildtype</p

Detection of TEX-14 the critical component of mammalian intercellular bridges in the SB-CAG-Venus rabbit testis.

<p>The image of TEX-14 staining in rabbit testis (red). The section was counterstained with TO-PRO-3 Iodide (blue). A: control, without primary antibody, B: Immunostaining with primary (TEX-14 polyclonal goat) and secondary (donkey anti-goat, Alexa Fluor 633) antibody. The presence of TEX-14 protein in the intercellular bridges is indicated by arrows.</p

The expression of Venus protein in epididymis from three SB transgenic homozygote mouse strains.

<p>The somatic cells showed Venus specific fluorescence, but spermatozoa did not express Venus protein. Note the differential expression between the characteristic cell types, e.g. narrow/clear cells compared to principal and basal cells. Epididymis sections of wild type mice did not show Venus specific fluorescence.A,B,C:#VL1; D,E,F:#VL3; G,H,I:#VL4; J,K,L: wildtype</p

Absence of Venus transcript in SB-CAG-VENUS spermatozoa.

<p>The following primer pairs were used in RT-PCR experiments: Fig 4A: YFP Venus specific primer:Forward: 5’ GGTCCCTCTTCTCGTTAGGG 3’ Reverse: 5’ TACAAGACCAGAGCCGAGGT 3’ Fig 4B: neonatal rabbit Fc receptor specific primer [<a href="http://www.plosone.org/article/info:doi/10.1371/journal.pone.0154489#pone.0154489.ref019" target="_blank">19</a>]; Fig 4C: ribosomal 28S subunit specific primer.Forward:5'GTTGTTGCCATGGTAATCCTGCTCAGT 3' Reverse: 5' TCTGACTTAGAGGCGTTCAGTCATAAT 3' RT-PCR of the buck’s sperm samples after percoll purification: <b>Line 1</b>: control wild type spermatozoa cDNA, <b>Line 2</b>: #4020 homozygote SB-CAG-Venus spermatozoa cDNA, <b>Line 3, 4</b>: #4017, #4012 hemizygote SB-CAG-Venus spermatozoa cDNA (percoll purified), <b>Line 5</b>: reference SB-CAG-Venus fibroblast, <b>Line 6</b>: no template RT-PCR, <b>Line 7</b>: no enzyme RT-PCR, <b>Line 8</b>: water control RT-PCR, L: DNA Ladder (GeneRuler 1Kb Plus). Venus transcripts were only detected in SB-CAG-Venus fibroblast samples.</p