A Characterisation of Strong Wave Tails in Curved Space-Times

A characterisation of when wave tails are strong is proposed. The existence of a curvature induced tail (i.e. a Green's function term whose support includes the interior of the light-cone) is commonly understood to cause backscattering of the field governed by the relevant wave equation. Strong tails are characterised as those for which the purely radiative part of the field is backscattered. With this definition, it is shown that electromagnetic waves in asymptotically flat space-times and fields governed by tail-free propagation have weak tails, but minimally coupled scalar fields in a cosmological scenario have strong tails.Comment: 17 pages, Revtex, to appear in Classical and Quantum Gravit

Against the complex versus simple distinction

This paper examines three proposals on the difference between complex and simple views about personal identity: Parfit’s original introduction of the distinction, Gasser and Stefan’s definition and Noonan’s recent proposal. I argue that the first two classify the paradigm cases of simplicity as complex, while Noonan’s proposal makes simplicity and complexity turn on features whose relevance for the distinction is questionable. Given these difficulties, I examine why we should be interested in whether a position is complex or simple. I describe two purposes of having a distinction, and show that extant accounts of the complex vs. simple distinction fail to serve these. I argue that unless we find a satisfying account of the difference between complex and simple positions, we should not frame discourses on personal identity in these terms.Publisher PDFPeer reviewe

Development of 10 microsatellite loci in the wolf spider Arctosa sancterosae (Araneae: Lycosidae)

Abstract Ten novel microsatellite loci were isolated from Arctosa sancterosae, a white dune dwelling species of wolf spider. Diversity was assessed in 273 individuals sampled from 11 populations along the Northern coast of the Gulf of Mexico. These new genetic markers will be useful for the description and conservation of these limited populations. Keywords Arachnids Á Coastal dune ecosystem Á Microsatellites Á Enriched library The white beach spider, Arctosa sancterosae, is a burrowing wolf spider endemic to the dune ecosystem of the northern coast of the Gulf of Mexico (NGC). Species endemic to this ecosystem are ideal for examining the effects of disturbance (e.g. hurricanes, habitat fragmentation/degradation) on population persistence. It is widely recognized that the primary threat to these populations is habitat fragmentation, but with the reduced gene flow associated with anthropogenic habitat modification and a predicted increase in the intensity of tropical storms We developed 10 novel microsatellite loci using the enrichment protocol of Glenn and Schable 2005. Whole genomic DNA was extracted from the legs of A. sancterosae using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA concentration was determined using a spectrophotometer and genomic DNA was then digested with the restriction enzymes RsaI and XmnI to yield fragments between 300 and 1,000 bp long. To the ends of these fragments we then ligated SuperSNX24 linkers (F; GTTTAAGG CCTAGCTAGCAGAATC, R; GATTCT GCTAGCTAGGCCTTAAACAAAA) and a polymerase chain reaction was performed to ensure ligation was successful. Genomic fragments were enriched using a probe mix containing four biotinylated oligonucleotides (AAT 10 , AAAT 7 , AAC 6 and AGAT 8 ) and separated with streptavidin magnetic beads. This mixture was washed with a 29 SSC, 0.1% SDS solution twice and a 19 SSC, 0.1% SDS solution four times. A magnetic particle collector was used between washes to capture the magnetic beads. After the last wash, fragments were removed from the probes by denaturing at 95°C for 5 min and precipitating with 95% ethanol and 3 M sodium acetate. These fragments were then air-dried and resuspended in 25 lL of TLE. To increase the quantity of these recovered enriched DNA we amplified the enriched pool by PCR using the SuperSNX24-F primer. These amplified fragments were then transformed and cloned using a TOPO TA Cloning Kit (45-0641). Blue-white selection revealed 288 clones that were then screened for inserts suitable (large enough) for microsatellite development by PCR using M13 forward and reverse primer

Modulation of Mcl-1 sensitizes glioblastoma to TRAIL-induced apoptosis

Glioblastoma (GBM) is the most aggressive form of primary brain tumour, with dismal patient outcome. Treatment failure is associated with intrinsic or acquired apoptosis resistance and the presence of a highly tumourigenic subpopulation of cancer cells called GBM stem cells. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) has emerged as a promising novel therapy for some treatment-resistant tumours but unfortunately GBM can be completely resistant to TRAIL monotherapy. In this study, we identified Mcl-1, an anti-apoptotic Bcl-2 family member, as a critical player involved in determining the sensitivity of GBM to TRAIL-induced apoptosis. Effective targeting of Mcl-1 in TRAIL resistant GBM cells, either by gene silencing technology or by treatment with R-roscovitine, a cyclin-dependent kinase inhibitor that targets Mcl-1, was demonstrated to augment sensitivity to TRAIL, both within GBM cells grown as monolayers and in a 3D tumour model. Finally, we highlight that two separate pathways are activated during the apoptotic death of GBM cells treated with a combination of TRAIL and R-roscovitine, one which leads to caspase-8 and caspase-3 activation and a second pathway, involving a Mcl-1:Noxa axis. In conclusion, our study demonstrates that R-roscovitine in combination with TRAIL presents a promising novel strategy to trigger cell death pathways in glioblastoma. Electronic supplementary material The online version of this article (doi:10.1007/s10495-013-0935-2) contains supplementary material, which is available to authorized users

Optimizing tuning masses for helicopter rotor blade vibration reduction including computed airloads and comparison with test data

The development and validation of an optimization procedure to systematically place tuning masses along a rotor blade span to minimize vibratory loads are described. The masses and their corresponding locations are the design variables that are manipulated to reduce the harmonics of hub shear for a four-bladed rotor system without adding a large mass penalty. The procedure incorporates a comprehensive helicopter analysis to calculate the airloads. Predicting changes in airloads due to changes in design variables is an important feature of this research. The procedure was applied to a one-sixth, Mach-scaled rotor blade model to place three masses and then again to place six masses. In both cases the added mass was able to achieve significant reductions in the hub shear. In addition, the procedure was applied to place a single mass of fixed value on a blade model to reduce the hub shear for three flight conditions. The analytical results were compared to experimental data from a wind tunnel test performed in the Langley Transonic Dynamics Tunnel. The correlation of the mass location was good and the trend of the mass location with respect to flight speed was predicted fairly well. However, it was noted that the analysis was not entirely successful at predicting the absolute magnitudes of the fixed system loads

Temperature dependence of surface reconstructions of Au on Pd(110)

Surface reconstructions of Au film on Pd(110) substrate are studied using a local Einstein approximation to quasiharmonic theory with the Sutton-Chen interatomic potential. Temperature dependent surface free energies for different coverages and surface structures are calculated. Experimentally observed transformations from $(1\times1)$ to $(1 \times 2)$ and $(1 \times 3)$ structures can be explained in the framework of this model. Also conditions for Stranski-Krastanov growth mode are found to comply with experiments. The domain of validity of the model neglecting mixing entropy is analyzed.Comment: 7 pages, REVTeX two-column format, 3 postscript figures available on request from [email protected] To appear in Phys. Rev. Letter

Women and Illegal Activities: Gender Differences and Women's Willingness to Comply Over Time

In recent years the topics of illegal activities such as corruption or tax evasion have attracted a great deal of attention. However, there is still a lack of substantial empirical evidence about the determinants of compliance. The aim of this paper is to investigate empirically whether women are more willing to be compliant than men and whether we observe (among women and in general) differences in attitudes among similar age groups in different time periods (cohort effect) or changing attitudes of the same cohorts over time (age effect) using data from eight Western European countries from the World Values Survey and the European Values Survey that span the period from 1981 to 1999. The results reveal higher willingness to comply among women and an age rather than a cohort effect. Working Paper 06-5

Complete Experimental Structure Determination of the p(3x2)pg Phase of Glycine on Cu{110}

We present a quantitative low energy electron diffraction (LEED) surface-crystallograpic study of the complete adsorption geometry of glycine adsorbed on Cu{110} in the ordered p(3×2) phase. The glycine molecules form bonds to the surface through the N atoms of the amino group and the two O atoms of the de-protonated carboxylate group, each with separate Cu atoms such that every Cu atom in the first layer is involved in a bond. Laterally, N atoms are nearest to the atop site (displacement 0.41 Å). The O atoms are asymmetrically displaced from the atop site by 0.54 Å and 1.18 Å with two very different O-Cu bond lengths of 1.93 Å and 2.18 Å. The atom positions of the upper-most Cu layers show small relaxations within 0.07 Å of the bulk-truncated surface geometry. The unit cell of the adsorbate layer consists of two glycine molecules, which are related by a glide-line symmetry operation. This study clearly shows that a significant coverage of adsorbate structures without this glide-line symmetry must be rejected, both on the grounds of the energy dependence of the spot intensities (LEED-IV curves) and of systematic absences in the LEED pattern

Navier-Stokes Simulation of a Heavy Lift Slowed-Rotor Compound Helicopter Configuration

Time accurate numerical simulations were performed using the Reynolds-averaged Navier-Stokes (RANS) flow solver OVERFLOW for a heavy lift, slowed-rotor, compound helicopter configuration, tested at the NASA Langley 14- by 22-Foot Subsonic Tunnel. The primary purpose of these simulations is to provide support for the development of a large field of view Particle Imaging Velocimetry (PIV) flow measurement technique supported by the Subsonic Rotary Wing (SRW) project under the NASA Fundamental Aeronautics program. These simulations provide a better understanding of the rotor and body wake flows and helped to define PIV measurement locations as well as requirements for validation of flow solver codes. The large field PIV system can measure the three-dimensional velocity flow field in a 0.914m by 1.83m plane. PIV measurements were performed upstream and downstream of the vertical tail section and are compared to simulation results. The simulations are also used to better understand the tunnel wall and body/rotor support effects by comparing simulations with and without tunnel floor/ceiling walls and supports. Comparisons are also made to the experimental force and moment data for the body and rotor