High resolution HLA analysis reveals independent class I haplotypes and amino-acid motifs protective for multiple sclerosis.

We investigated association between HLA class I and class II alleles and haplotypes, and KIR loci and their HLA class I ligands, with multiple sclerosis (MS) in 412 European American MS patients and 419 ethnically matched controls, using next-generation sequencing. The DRB1*15:01~DQB1*06:02 haplotype was highly predisposing (odds ratio (OR) = 3.98; 95% confidence interval (CI) = 3-5.31; p-value (p) = 2.22E-16), as was DRB1*03:01~DQB1*02:01 (OR = 1.63; CI = 1.19-2.24; p = 1.41E-03). Hardy-Weinberg (HW) analysis in MS patients revealed a significant DRB1*03:01~DQB1*02:01 homozyote excess (15 observed; 8.6 expected; p = 0.016). The OR for this genotype (5.27; CI = 1.47-28.52; p = 0.0036) suggests a recessive MS risk model. Controls displayed no HW deviations. The C*03:04~B*40:01 haplotype (OR = 0.27; CI = 0.14-0.51; p = 6.76E-06) was highly protective for MS, especially in haplotypes with A*02:01 (OR = 0.15; CI = 0.04-0.45; p = 6.51E-05). By itself, A*02:01 is moderately protective, (OR = 0.69; CI = 0.54-0.87; p = 1.46E-03), and haplotypes of A*02:01 with the HLA-B Thr80 Bw4 variant (Bw4T) more so (OR = 0.53; CI = 0.35-0.78; p = 7.55E-04). Protective associations with the Bw4 KIR ligand resulted from linkage disequilibrium (LD) with DRB1*15:01, but the Bw4T variant was protective (OR = 0.64; CI = 0.49-0.82; p = 3.37-04) independent of LD with DRB1*15:01. The Bw4I variant was not associated with MS. Overall, we find specific class I HLA polymorphisms to be protective for MS, independent of the strong predisposition conferred by DRB1*15:01

Response to comment on "Human-specific gain of function in a developmental enhancer"

Duret and Galtier argue that human-specific sequence divergence and gain of function in the HACNS1 enhancer result from deleterious biased gene conversion (BGC) with no contribution from positive selection. We reinforce our previous conclusion by analyzing hypothesized BGC events genomewide and assessing the effect of recombination rates on human-accelerated conserved noncoding sequence ascertainment. We also provide evidence that AT → GC substitution bias can coexist with positive selection

Development of 10 microsatellite loci in the wolf spider Arctosa sancterosae (Araneae: Lycosidae)

Abstract Ten novel microsatellite loci were isolated from Arctosa sancterosae, a white dune dwelling species of wolf spider. Diversity was assessed in 273 individuals sampled from 11 populations along the Northern coast of the Gulf of Mexico. These new genetic markers will be useful for the description and conservation of these limited populations. Keywords Arachnids Á Coastal dune ecosystem Á Microsatellites Á Enriched library The white beach spider, Arctosa sancterosae, is a burrowing wolf spider endemic to the dune ecosystem of the northern coast of the Gulf of Mexico (NGC). Species endemic to this ecosystem are ideal for examining the effects of disturbance (e.g. hurricanes, habitat fragmentation/degradation) on population persistence. It is widely recognized that the primary threat to these populations is habitat fragmentation, but with the reduced gene flow associated with anthropogenic habitat modification and a predicted increase in the intensity of tropical storms We developed 10 novel microsatellite loci using the enrichment protocol of Glenn and Schable 2005. Whole genomic DNA was extracted from the legs of A. sancterosae using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA concentration was determined using a spectrophotometer and genomic DNA was then digested with the restriction enzymes RsaI and XmnI to yield fragments between 300 and 1,000 bp long. To the ends of these fragments we then ligated SuperSNX24 linkers (F; GTTTAAGG CCTAGCTAGCAGAATC, R; GATTCT GCTAGCTAGGCCTTAAACAAAA) and a polymerase chain reaction was performed to ensure ligation was successful. Genomic fragments were enriched using a probe mix containing four biotinylated oligonucleotides (AAT 10 , AAAT 7 , AAC 6 and AGAT 8 ) and separated with streptavidin magnetic beads. This mixture was washed with a 29 SSC, 0.1% SDS solution twice and a 19 SSC, 0.1% SDS solution four times. A magnetic particle collector was used between washes to capture the magnetic beads. After the last wash, fragments were removed from the probes by denaturing at 95°C for 5 min and precipitating with 95% ethanol and 3 M sodium acetate. These fragments were then air-dried and resuspended in 25 lL of TLE. To increase the quantity of these recovered enriched DNA we amplified the enriched pool by PCR using the SuperSNX24-F primer. These amplified fragments were then transformed and cloned using a TOPO TA Cloning Kit (45-0641). Blue-white selection revealed 288 clones that were then screened for inserts suitable (large enough) for microsatellite development by PCR using M13 forward and reverse primer

The matrix protein Fibulin-3 promotes KISS1R induced triple negative breast cancer cell invasion

Breast cancer is a leading cause of cancer mortality. In particular, triple negative breast cancer (TNBC) comprise a heterogeneous group of basal-like tumors lacking estrogen receptor (ERa), progesterone receptor (PR) and HER2 (ErbB2). TNBC represents 15-20% of all breast cancers and occurs frequently in women under 50 years of age. Unfortunately, these patients lack targeted therapy, are typically high grade and metastatic at time of diagnosis. The mechanisms regulating metastasis remain poorly understood. We have previously shown that the kisspeptin receptor, KISS1R stimulates invasiveness of TNBC cells. In this report, we demonstrate that KISS1R signals via the secreted extracellular matrix protein, fibulin-3, to regulate TNBC invasion. We found that the fibulin-3 gene is amplified in TNBC primary tumors and that plasma fibulin-3 levels are elevated in TNBC patients compared to healthy subjects. In this study, we show that KISS1R activation increases fibulin-3 expression and secretion. We show that fibulin-3 regulates TNBC metastasis in a mouse experimental metastasis xenograft model and signals downstream of KISS1R to stimulate TNBC invasion, by activating matrix metalloproteinase 9 (MMP-9) and the MAPK pathway. These results identify fibulin-3 as a new downstream mediator of KISS1R signaling and as a potential biomarker for TNBC progression and metastasis, thus revealing KISS1R and fibulin-3 as novel drug targets in TNBC

An ancient adaptive episode of convergent molecular evolution confounds phylogenetic inference

Convergence can mislead phylogenetic inference by mimicking shared ancestry, but has been detected only rarely in molecular evolution. Here, we show that significant convergence occurred in snake and agamid lizard mitochondrial genomes. Most evidence, and most of the mitochondrial genome, supports one phylogenetic tree, but a subset of mostly amino acid-altering mitochondrial sites strongly support a radically different phylogeny. These sites are convergent, probably selected, and overwhelm the signal from other sites. This suggests that convergent molecular evolution can seriously mislead phylogenetics, even with large data sets. Radical phylogenies inconsistent with previous evidence should be treated cautiously

Dnmt3a regulates emotional behavior and spine plasticity in the nucleus accumbens.

Despite abundant expression of DNA methyltransferases (Dnmts) in brain, the regulation and behavioral role of DNA methylation remain poorly understood. We found that Dnmt3a expression was regulated in mouse nucleus accumbens (NAc) by chronic cocaine use and chronic social defeat stress. Moreover, NAc-specific manipulations that block DNA methylation potentiated cocaine reward and exerted antidepressant-like effects, whereas NAc-specific Dnmt3a overexpression attenuated cocaine reward and was pro-depressant. On a cellular level, we found that chronic cocaine use selectively increased thin dendritic spines on NAc neurons and that DNA methylation was both necessary and sufficient to mediate these effects. These data establish the importance of Dnmt3a in the NAc in regulating cellular and behavioral plasticity to emotional stimuli

Rensching cats and dogs: feeding ecology and fecundity trends explain variation in the allometry of sexual size dimorphism

The tendency for sexual size dimorphism (SSD) to increase with body mass in taxa where males are larger, and to decrease when females are larger, is known as Rensch's rule. In mammals, where the trend occurs, it is believed to be the result of a competitive advantage for larger males, while female mass is constrained by the energetics of reproduction. Here, we examine the allometry of SSD within the Felidae and Canidae, demonstrating distinctly different patterns: in felids, there is positive allometric scaling, while there is no trend in canids. We hypothesize that feeding ecology, via its effect on female spacing patterns, is responsible for the difference; larger male mass may be advantageous only where females are dispersed such that males can defend access to them. This is supported by the observation that felids are predominately solitary, and all are obligate carnivores. Similarly, carnivorous canids are more sexually dimorphic than insectivores and omnivores, but carnivory does not contribute to a Rensch effect as dietary variation occurs across the mass spectrum. The observed inter-familial differences are also consistent with reduced constraints on female mass in the canids, where litter size increases with body mass, versus no observable allometry in the felids

Passive Transdermal Systems Whitepaper Incorporating Current Chemistry, Manufacturing and Controls (CMC) Development Principles

In this whitepaper, the Manufacturing Technical Committee (MTC) of the Product Quality Research Institute has updated the 1997 Transdermal Drug Delivery Systems Scale-Up and Post Approval Change workshop report findings to add important new product development and control principles. Important topics reviewed include ICH harmonization, quality by design, process analytical technologies, product and process validation, improvements to control of critical excipients, and discussion of Food and Drug Administration’s Guidance on Residual Drug in Transdermal and Related Drug Delivery Systems as well as current thinking and trends on in vitro–in vivo correlation considerations for transdermal systems