64 research outputs found
Diffusion of Chemically Reactive Species in Stagnation-Point Flow of a Third Grade Fluid: a Hybrid Numerical Method
The boundary layer flow of a third grade fluid and mass transfer near a stagnation-point with diffusion of
chemically reacting species on a porous plate is investigated. Due to a porous plate the suction is taken into an
account. Using suitable transformations, the momentum and concentration equations are first transformed into
nonlinear ordinary ones and then solved using a hybrid numerical method. This method combines the features
of finite difference and shooting methods. The effects of various controlling parameters on the flow velocity,
concentration profile, skin friction and rate of mass transfer on surface are analyzed graphically and in tabular
form. Comparison of the present results with the previous reported results has been found in excellent
agreement
Intracytoplasmic sperm injection outcome using ejaculated sperm and retrieved sperm in azoospermic men.
Introduction:We aimed to determine pregnancy and miscarriage rates following intracytoplasmic sperm injection (ICSI) cycles using retrieved epididymal and testicular sperm in azoospermic men and ejaculated sperm in oligospermic and normospermic men. Materials AndMethods: This retrospective study was carried out on 517 couples who underwent ICSI. They included 96 couples with azoospermia and 421 with oligospermia or normal sperm count in the male partner. Of the men with azoospermia, 69 underwent percutaneous epididymal aspiration (PESA) and 47 underwent testicular sperm extraction (TESE). In the 421 men with oligospermia or normal sperm count, ejaculated sperm was used for ICSI. The differences in the outcomes of ICSI using PESA or TESE and ejaculated sperm were evaluated. The main outcome measures were pregnancy and miscarriage rates.Results: No significant differences were seen in pregnancy and miscarriage rates with surgically retrieved and ejaculated sperm. The pregnancy rates (including frozen embryo transfer) were 43.5%, 36.2%, and 41.4% in couples with PESA, TESE, and ejaculated sperm, respectively (P = .93). The miscarriage rates were 16.7%, 23.5%, and 12.1%, respectively (P = .37).Conclusion: Intracytoplasmic sperm injection in combination with PESA and TESE is an effective method and can successfully be performed to treat men with azoospermia. The outcomes with these procedures are comparable to ICSI using ejaculated sperm
An Investigation of Household Reproductive Behaviour in Pakistan
Our present concern is with fertility determinants on Pakistan. Based on the household data co11cted in connection with PIDE/ILO project "Studies in Population, Labour Ircrce and Migration in Pakistan" an attempt is made to ascertain the influence of various socio-economic variables on household fertility decision making. The analysis which follows is preliminary in nature and can be characterised as taking a general socio-economic approach.
Various fertility measures available from the survey are described in this paper followed by a discussion on the choice and specification of independent variables in the next section. Regression results are presented in the third section
Investigation of the cardiac depressant effect of Caralluma tuberculate N.E.Br on isolated rabbit heart
Purpose: To investigate the histopathological and cardiac depressant effect of the aqueous methanol extract of Caralluma tuberculata N.E. Br (AMECT) (family: Asclepiadaceae)’ and to determine if there is a scientific basis for its cardiovascular diseases-related folkloric use.
Methods: The effect of AMECT in different concentrations ranging from 0.00001 to 1.0 mg/mL were evaluated in isolated perfused rabbit heart to assess their effect on the force of contraction and heart rate using Langendorff’s apparatus. Atropine and adrenaline were used to identify the underlying mechanism of response produced by AMECT. The extract was studied for its possible mechanism in the absence and presence of atropine and adrenaline. In addition, sub-chronic toxicity and histopathological study of heart tissues in rats were assessed by administering 500 mg/kg of extract.
Results: At all concentrations, AMECT produced significant (p < 0.001) negative ionotropic and negative chronotropic effects. The most significant effect was observed at 0.001 mg/mL and higher concentrations hence 0.001 mg/mL was selected for further studies. Pre-incubation with atropine did not significantly inhibit the effects of AMECT. However, AMECT significantly (p < 0.01) blocked the cardiac stimulant effect of adrenaline. In the histopathological studies, AMECT did not produce any significant cellular changes or signs of toxicity in the sub-chronic toxicity study.
Conclusion: The cardiac-depressant responses of AMECT may involve the β-adrenergic receptors in the myocardium of isolated rabbit heart thus confirming the rationale for its use in ethnomedicine for cardiac diseases
On smart gaze based annotation of histopathology images for training of deep convolutional neural networks
Unavailability of large training datasets is a bottleneck that needs to be overcome to realize the true potential of deep learning in histopathology applications. Although slide digitization via whole slide imaging scanners has increased the speed of data acquisition, labeling of virtual slides requires a substantial time investment from pathologists. Eye gaze annotations have the potential to speed up the slide labeling process. This work explores the viability and timing comparisons of eye gaze labeling compared to conventional manual labeling for training object detectors. Challenges associated with gaze based labeling and methods to refine the coarse data annotations for subsequent object detection are also discussed. Results demonstrate that gaze tracking based labeling can save valuable pathologist time and delivers good performance when employed for training a deep object detector. Using the task of localization of Keratin Pearls in cases of oral squamous cell carcinoma as a test case, we compare the performance gap between deep object detectors trained using hand-labelled and gaze-labelled data. On average, compared to 'Bounding-box' based hand-labeling, gaze-labeling required 57.6% less time per label and compared to 'Freehand' labeling, gaze-labeling required on average 85% less time per label
Molecular characterization of capsid protein gene of potato virus X from Pakistan
Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei
Cellular community detection for tissue phenotyping in colorectal cancer histology images
Classification of various types of tissue in cancer histology images based on the cellular compositions is an important step towards the development of computational pathology tools for systematic digital profiling of the spatial tumor microenvironment. Most existing methods for tissue phenotyping are limited to the classification of tumor and stroma and require large amount of annotated histology images which are often not available. In the current work, we pose the problem of identifying distinct tissue phenotypes as finding communities in cellular graphs or networks. First, we train a deep neural network for cell detection and classification into five distinct cellular components. Considering the detected nuclei as nodes, potential cell-cell connections are assigned using Delaunay triangulation resulting in a cell-level graph. Based on this cell graph, a feature vector capturing potential cell-cell connection of different types of cells is computed. These feature vectors are used to construct a patch-level graph based on chi-square distance. We map patch-level nodes to the geometric space by representing each node as a vector of geodesic distances from other nodes in the network and iteratively drifting the patch nodes in the direction of positive density gradients towards maximum density regions. The proposed algorithm is evaluated on a publicly available dataset and another new large-scale dataset consisting of 280K patches of seven tissue phenotypes. The estimated communities have significant biological meanings as verified by the expert pathologists. A comparison with current state-of-the-art methods reveals significant performance improvement in tissue phenotyping
Impact of High Volume Energy Drink Consumption on Electrocardiographic and Blood Pressure Parameters: A Randomized Trial
Background Energy drinks have been linked to an increase in emergency room visits and deaths. We aim to determine the impact of energy drinks on electrocardiographic and hemodynamic parameters in young healthy volunteers. Methods and Results A randomized, double-masked, placebo-controlled, crossover study was conducted in healthy volunteers. Participants consumed 32 oz of either energy drink A, energy drink B, or placebo within 60 minutes on 3 study days with a 6-day washout period in between. The primary end point of QT c interval and secondary end points of QT interval, PR interval, QRS duration, heart rate, and brachial and central blood pressures were measured at baseline, and every 30 minutes for 240 minutes. A repeated-measures 2-way analysis of variance was performed with the main effects of intervention, time, and an interaction of intervention and time. Thirty-four participants were included (age 22.1±3.0 years). The interaction term of intervention and time was statistically significant for Bazett\u27s corrected QT interval, Fridericia\u27s corrected QT interval, QT , PR , QRS duration, heart rate, systolic blood pressure, diastolic blood pressure, central systolic blood pressure, and central diastolic blood pressure (all
Mutations in mitochondrial enzyme GPT2 cause metabolic dysfunction and neurological disease with developmental and progressive features
Mutations that cause neurological phenotypes are highly informative with regard to mechanisms governing human brain function and disease. We report autosomal recessive mutations in the enzyme glutamate pyruvate transaminase 2 (GPT2) in large kindreds initially ascertained for intellectual and developmental disability (IDD). GPT2 [also known as alanine transaminase 2 (ALT2)] is one of two related transaminases that catalyze the reversible addition of an amino group from glutamate to pyruvate, yielding alanine and α-ketoglutarate. In addition to IDD, all affected individuals show postnatal microcephaly and ∼80% of those followed over time show progressive motor symptoms, a spastic paraplegia. Homozygous nonsense p.Arg404* and missense p.Pro272Leu mutations are shown biochemically to be loss of function. The GPT2 gene demonstrates increasing expression in brain in the early postnatal period, and GPT2 protein localizes to mitochondria. Akin to the human phenotype, Gpt2-null mice exhibit reduced brain growth. Through metabolomics and direct isotope tracing experiments, we find a number of metabolic abnormalities associated with loss of Gpt2. These include defects in amino acid metabolism such as low alanine levels and elevated essential amino acids. Also, we find defects in anaplerosis, the metabolic process involved in replenishing TCA cycle intermediates. Finally, mutant brains demonstrate misregulated metabolites in pathways implicated in neuroprotective mechanisms previously associated with neurodegenerative disorders. Overall, our data reveal an important role for the GPT2 enzyme in mitochondrial metabolism with relevance to developmental as well as potentially to neurodegenerative mechanisms.National Institute of Neurological Diseases and Stroke (U.S.) (R01NS035129)United States. National Institutes of Health (R21TW008223)National Cancer Institute (U.S.) (R01CA157996
- …