A Combinatorial Framework for Designing (Pseudoknotted) RNA Algorithms

We extend an hypergraph representation, introduced by Finkelstein and Roytberg, to unify dynamic programming algorithms in the context of RNA folding with pseudoknots. Classic applications of RNA dynamic programming energy minimization, partition function, base-pair probabilities...) are reformulated within this framework, giving rise to very simple algorithms. This reformulation allows one to conceptually detach the conformation space/energy model -- captured by the hypergraph model -- from the specific application, assuming unambiguity of the decomposition. To ensure the latter property, we propose a new combinatorial methodology based on generating functions. We extend the set of generic applications by proposing an exact algorithm for extracting generalized moments in weighted distribution, generalizing a prior contribution by Miklos and al. Finally, we illustrate our full-fledged programme on three exemplary conformation spaces (secondary structures, Akutsu's simple type pseudoknots and kissing hairpins). This readily gives sets of algorithms that are either novel or have complexity comparable to classic implementations for minimization and Boltzmann ensemble applications of dynamic programming

Internet of Things in Water Management and Treatment

The goal of the water security IoT chapter is to present a comprehensive and integrated IoT based approach to environmental quality and monitoring by generating new knowledge and innovative approaches that focus on sustainable resource management. Mainly, this chapter focuses on IoT applications in wastewater and stormwater, and the human and environmental consequences of water contaminants and their treatment. The IoT applications using sensors for sewer and stormwater monitoring across networked landscapes, water quality assessment, treatment, and sustainable management are introduced. The studies of rate limitations in biophysical and geochemical processes that support the ecosystem services related to water quality are presented. The applications of IoT solutions based on these discoveries are also discussed

Automated Differential Display Using a Fluorescently Labeled Universal Primer

We have modified the automated differential display reverse transcription polymerase chain reaction technique (DDRTPCR) such that a single fluorescently labeled universal primer (d[F]CTCACGGATCCGTCGATTTT) is used in all PCRs together with a selection of arbitrary primers. We term this fluorescent detection procedure FDDRT-PCR. Anchoring primers of general structure dTGGTCTCACGGATCCGTCGA- (T)12 VN (where N can be any deoxynucleoside and V can be any deoxynucleoside other than thymidine) are used for the RT step, and the universal primer together with selected arbitrary primers are then used for the PCR amplification. Advantages of this approach are: (i) the fluorescently labeled universal primer is a constant feature in every PCR, so that changes in banding profile are highly likely to reflect the incorporation of different arbitrary 10-mer primers; (ii) artifacts that result from arbitrary 10-mer to arbitrary 10- mer primer amplifications are not observed by fluoresence detection on an automated gene scanner because such products are not fluorescently labeled; (iii) sample throughput and ease of data handling are increased when compared with the conventional radioactive/ manual approach and (iv) using a single fluorescently labeled primer in all PCRs is highly cost-effective

ncRNA-Class Web Tool: Non-coding RNA Feature Extraction and Pre-miRNA Classification Web Tool

Part 8: First Workshop on Algorithms for Data and Text Mining in Bioinformatics (WADTMB 2012)International audienceUntil recently, it was commonly accepted that most genetic information is transacted by proteins. Recent evidence suggests that the majority of the genomes of mammals and other complex organisms are in fact transcribed into non-coding RNAs (ncRNAs), many of which are alternatively spliced and/or processed into smaller products. Non coding RNA genes analysis requires the calculation of several sequential, thermodynamical and structural features. Many independent tools have already been developed for the efficient calculation of such features but to the best of our knowledge there does not exist any integrative approach for this task. The most significant amount of existing work is related to the miRNA class of non-coding RNAs. MicroRNAs (miRNAs) are small non-coding RNAs that play a significant role in gene regulation and their prediction is a challenging bioinformatics problem. Non-coding RNA feature extraction and pre-miRNA classification Web Tool (ncRNA-class Web Tool) is a publicly available web tool (http://150.140.142.24:82/Default.aspx) which provides a user friendly and efficient environment for the effective calculation of a set of 58 sequential, thermodynamical and structural features of non-coding RNAs, plus a tool for the accurate prediction of miRNAs

Expression of Anthocyanins in Callus Cultures of Cranberry (\u3ci\u3eVaccinium macrocarpon Ait\u3c/i\u3e)

Expression of anthocyanins and other flavonoids in callus cultures established from different parts of cranberry plant was investigated and the effect of explant source on the in vitro product was determined. Callus cultures were initiated from different parts of the plant in a modified Gamborg\u27s medium with 5.37 μM α-naphthaleneacetic acid, 0.45 μM 2,4-dichlorophenoxyacetic acid, and 2.32 μM kinetin in the dark at 25°C. Callus cultures accumulated anthocyanins only on exposure to light and maximum concentration was observed by day 12. The cultures had lower levels of anthocyanins and only cyanidin 3-galactoside, cyanidin 3-glucoside, and cyanidin 3-arabinoside were identified in all cultures regardless of source of explant. Proanthocyanidin accumulation in cultures was independent of light, and levels were higher than in mature fruit. Exposure to light induced accumulation of flavonols and enhanced activity of phenylalanine ammonia-lyase in the cultures