1,316 research outputs found
Fetal and early neonatal interleukin-6 response
In 1998, a systemic fetal cytokine response, defined as a plasma interleukin-6 (IL-6) value above 11 pg/mL, was reported to be a major independent risk factor for the subsequent development of neonatal morbid events even after adjustments for gestational age and other confounders. Since then, the body of literature investigating the use of blood concentrations of IL-6 as a hallmark of the fetal inflammatory response syndrome (FIRS), a diagnostic marker of early-onset neonatal sepsis (EONS) and a risk predictor of white matter injury (WMI), has grown rapidly. In this article, we critically review: IL-6 biological functions; current evidence on the association between IL-6, preterm birth, FIRS and EONS; IL-6 reference intervals and dynamics in the early neonatal period; IL-6 response during the immediate postnatal period and perinatal confounders; accuracy and completeness of IL-6 diagnostic studies for EONS (according to the Standards for Reporting of Diagnostic Accuracy statement); and recent breakthroughs in the association between fetal blood IL-6, EONS, and WMI
Exponential speed of mixing for skew-products with singularities
Let be the
endomorphism given by where is a positive real number. We prove that is
topologically mixing and if then is mixing with respect to Lebesgue
measure. Furthermore we prove that the speed of mixing is exponential.Comment: 23 pages, 3 figure
First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia
Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia
New oxaliplatin-pyrophosphato analogs with improved in vitro cytotoxicity
Two new Pt(II)-pyrophosphato complexes containing the carrier ligands cis-1,3- diaminocyclohexane (cis-1,3-DACH) and trans-1,2-diamine-4-cyclohexene (1,2-DACHEX), variants of the 1R,2R-diaminocyclohexane ligand present in the clinically used Pt-drug oxaliplatin, have been synthesized with the aim of developing new potential antitumor drugs with high bone tropism. The complexes are more stable at physiological pH than in acid conditions, with Na2[Pt(pyrophosphato)(cis-1,3-DACH)] (1) slightly more stable than Pt(dihydrogenpyrophosphato)(1,2-DACHEX)] (2). The greater reactivity at acidic pH ensures a greater efficacy at the tumor site. Preliminary NMR studies indicate that 1 and 2 react slowly with 5’-GMP (used as a model of nucleic acids), releasing the pyrophosphate ligand and affording the bis 5’-GMP adduct. In vitro cytotoxicity assays performed against a panel of four human cancer cell lines have shown that both compounds are more active than oxaliplatin. Flow cytometry studies on HCT116 cells showed that the pyrophosphato compounds with the non-classical 1,3- and 1,4- diaminocyclohexane ligands (1 and 4) are the most capable to induce cells’ death by apoptosis and necrosis
Chlamydia trachomatis-associated respiratory disease in the very early neonatal period
Of 103 preterm neonates admitted consecutively to the neonatal intensive care unit soon after birth for respiratory distress, 8 were found to be Chlamydia trachomatis-positive as early as within the first 24 h of life. All these patients required mechanical ventilation and supplemental oxygen. Six infants had evidence on chest radiographs of hyaline membrane disease, one of pneumonia, and one of slight bilateral parenchymal changes. Our results suggest that the presence of C. trachomatis in preterm infants with neonatal respiratory distress is probably not an infrequent event
Valle agricola chickpeas: Nutritional profile and metabolomics traits of a typical landrace legume from southern Italy
Chickpea (Cicer arietinum L.) from Valle Agricola is a legume cultivated in Southern Italy whose intake is strictly linked to rural traditions. In order to get new biochemical insight on this landrace and to promote its consumption and marketing, nutritional values (moisture content, total proteins, lipids, total and free amino acids) and metabolic traits are deeply investigated. Valle Agricola chickpea is nutritionally rich in proteins (19.70 g/100 g) and essential amino acids (7.12 g/100 g; ~40% of total). Carbohydrates, whose identity was unraveled by means of UHPLC-HR MS/MS analysis, were almost 60% of chemicals. In particular, a di-galactosylglycerol, a pinitol digalactoside, and a galactosylciceritol were found as constitutive, together with different raffinose-series oligosaccharides. Although lipids were the less constitutive compounds, glycerophospholipids were identified, while among free fatty acids linoleic acid (C18:2) was the most abundant, followed by oleic (C18:1) and palmitic (C16:0) acids. Isoflavones and hydroxybenzoic acid derivatives were also detected. Valle Agricola chickpeas showed very good levels of several mineral nutrients, especially magnesium (164 mg/100 g), potassium (748 mg/100 g), calcium (200 mg/100 g), zinc (4.20 mg/100 g) and manganese (0.45 mg/100 g). The boiling process favorably decreases anti-trypsin and anti-chymotrypsin activities, depleting this precious seed of its intrinsic antinutritional factors
Robust entropy expansiveness implies generic domination
Let be a -diffeomorphism, , defined on a compact
boundaryless -dimensional manifold , , and let be the
homoclinic class associated to the hyperbolic periodic point . We prove that
if there exists a neighborhood of such that for every
the continuation of is entropy-expansive
then there is a -invariant dominated splitting for of the form
where is contracting, is
expanding and all are one dimensional and not hyperbolic.Comment: 24 page
Exoskeletons for workers: A case series study in an enclosures production line
This case-series study aims to investigate the effects of a passive shoulder support exoskeleton on experienced workers during their regular work shifts in an enclosures production site. Experimental activities included three sessions, two of which were conducted in-field (namely, at two workstations of the painting line, where panels were mounted and dismounted from the line; each session involved three participants), and one session was carried out in a realistic simulated environment (namely, the workstations were recreated in a laboratory; this session involved four participants). The effect of the exoskeleton was evaluated through electromyographic activity and perceived effort. After in-field sessions, device usability and user acceptance were also assessed. Data were reported individually for each participant. Results showed that the use of the exoskeleton reduced the total shoulder muscular activity compared to normal working conditions, in all subjects and experimental sessions. Similarly, the use of the exoskeleton resulted in reductions of the perceived effort in the shoulder, arm, and lower back. Overall, participants indicated high usability and acceptance of the device. This case series invites larger validation studies, also in diverse operational contexts
Synthesis of folic acid functionalized gold nanoclusters for targeting folate receptor-positive cells
We report on the synthesis of water-soluble gold nanoclusters capped with polyethylene glycol (PEG)-based ligands and further functionalized with folic acid for specific cellular uptake. The dihydrolipoic acid-PEG-based ligands terminated with -OMe, -NH2 and -COOH functional groups are produced and used for surface passivation of Au nanoclusters (NCs) with diameters <2 nm. The produced sub 2 nm Au NCs possess long-shelf life and are stable in physiologically relevant environments (temperature and pH), are paramagnetic and biocompatible. The paramagnetism of Au NCs in solution is also reported. The functional groups on the capping ligands are used for direct conjugation of targeting molecules onto Au NCs without the need for post synthesis modification. Folic acid (FA) is attached via an amide group and effectively target cells expressing the folate receptor. The combination of targeting ability, biocompatibility and paramagnetism in FA-functionalized Au NCs is of relevance for their exploitation in nanomedicine for targeted imaging
- …