Spermatozoa induce transcriptomic alterations in bovine oviductal epithelial cells prior to initial contact

The capability of spermatozoa to directly influence maternal gene expression is already established. Indeed, some of the changes induced by spermatozoa may have a direct functional importance in the pre-conceptional period. Although the mechanisms underlying these sperm-maternal interactions are not well characterized, it is possible that they could involve ligands that are released from the spermatozoa. This study therefore aimed to test whether physical contact between bovine spermatozoa and bovine oviductal epithelial cells (BOECs) is a prerequisite for spermatozoa-induced gene expression changes. We used two co-culture models: a contact co-culture model in which spermatozoa interact directly with BOECs, and a non-contact co-culture model in which an insert with the pore size of 0.4 μm was placed between spermatozoa and BOECs. Messenger RNA sequencing analysis of BOECs by RNA-seq revealed ten differentially expressed genes in contact system and 108 differentially expressed genes in the non-contact system after 10 h of co-culture. Retinol metabolism pathway and ovarian steroidogenesis pathway were significantly enriched in the non-contact co-culture system. Q-PCR analysis revealed that transcriptional responses can be rapid, with increased expression of four genes (DHRS3, CYP1B1, PTGS2, and ATF3) detectable within just 90 min of co-incubation, but with expression levels highly dependent on the type of co-culture system. The findings from our study demonstrate that direct contact with spermatozoa is not necessary to induce changes in gene expression of oviductal epithelial cells, suggesting that spermatozoa may be able to signal to maternal tissues in advance of their arrival

49 Effects of culture conditions and gene transfection on the development of bovine somatic cell nuclear transfer embryos

Somatic cell nucleus transfer (SCNT) and in vitro culture of reconstructed embryos are the pivotal steps for successful cloning and generation of transgenic cattle. The aim of the study was to determine the influence of different cell fusion parameters, maturation, and culture conditions and the type of a cell line (bovine fetal fibroblast cell lines with or without gene transfection) on SCNT blastocyst development. Slaughterhouse-derived oocytes were matured for 17 h in TCM-199 (Sigma, St. Louis, MO, USA) supplemented with 0.05 µg mL–1 of epidermal growth factor (EGF) and 15 IU mL–1 of hCG/eCG (Intervet, PG600) or 10 µg mL–1 of FSH and 12.5 mU mL–1 of LH (Sioux Biochemical Inc., Sioux Center, IA, USA). Four fetal fibroblast cell lines (4 to 5 passages) and identical cell lines transfected with plasmid containing either human erythropoietin, FSH, growth hormone, or insulin-coding cDNA under β-casein promoter (7 to 9 passages) were used for SCNT. Cell fusion was induced by 2 direct-current pulses in 0.5 or 0.2 micro fusion chambers (Eppendorf Multiporator) using one of the following treatments: 100V for 15 µs (F1), 65V for 25 µs (F2), 65V for 20 µs (F3; all in a 0.5-mm chamber), or 36V for 25 µs (F4; 0.2-mm chamber). Fused complexes were activated with 4 µg mL–1 of Ca-ionophore for 4 min and then incubated for 5 h in 2 mM DMAP. The embryos were cultured in SOFaaci medium (Holm et al. 1999) or in commercial SOF medium (Minitüb GmbH, Tiefenbach, Germany) for 7 days. Data were analysed by ANOVA and the chi-square test. The results of the study showed that the cleavage rate of the reconstructed embryos was influenced by the fusion regimen (P < 0.05) but not by the donor cell type (P < 0.05). Treatments F2 and F3 resulted in cleavage rates higher (P < 0.05) than F1 and F4 (77.2, 82.0, 62.8, and 63.1%, respectively). Blastocyst yield was not significantly influenced by the different in vitro maturation (IVM) media – altogether, addition of FSH/LH resulted in 14.6% (158/1079) and EGF + hCG/eCG in 13.2% (73/554) of blastocysts (P < 0.05). The combination of TCM-199 + FSH/LH and SOFaaci resulted in 19.6% (79/403) blastocysts compared with 12.4% (74/596) when the same IVM medium and commercial SOF were used (P < 0.05). The use of transgenic cell lines for cloning led to a lower overall blastocyst rate (10.9%, 38/348) than use of non-transfected cell lines (17.7%, 115/651; P < 0.05), whereas the differences were 5.6 and 4.1 percentage points for SOF and SOFaaci, respectively. There were no significant differences between the individual cell lines within a cell line type. In conclusion, the optimization of the fusion parameters and in vitro culture (IVC) conditions led to improved blastocyst yields. In vivo development potential of the generated embryos still has to be evaluated in further studies

36 transgenic somatic cell nuclear transfer blastocyst selection with embryo biopsying

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.93%), of which 12 (54.54%) were TG positive blastocysts and selected for transfer. Our hFSH TG fibroblast cell line demonstrated a low concentration of TG cells in its culture, despite the selection and verification methods applied. Based on the analysis of SCNT embryos, only 54.54% of the embryos developed were TG positive. The embryo biopsying technique enables us to use only TG-positive SCNT cloned embryos for transfer, therefore avoiding non-TG pregnancies

85 Low-Molecular-Weight metabolites in bovine In Vitro production culture media as embryo quality markers

The need for noninvasive embryo quality assessment techniques has increased as the in vitro production of cattle embryos has become more popular and necessary in the beef and milk production industries. In this study, we assessed the metabolomic profile of embryo culture media to determine whether it is possible to evaluate differences in low-molecular-weight metabolites in the culture media composition of morula stage embryos compared with embryos that develop to the blastocyst stage. Single bovine embryos were cultured in 60-µL SOF+0.4% BSA droplets under mineral oil. Twenty microliters of culture media was removed at Day 2, 5, and 8 post-fertilization. Cultured droplets without a zygote served as the control samples. A total of 42 samples were analysed using liquid chromatography-mass spectrometry (Q-Trap 3200, Ab Sciex, Framingham, MA, USA), followed by principal component analysis. Our preliminary results indicated significant differences (P < 0.00001) in 10 low-molecular-weight compounds between the groups. Three of those compounds (588, 589, and 702 Da) were represented in higher concentrations only in embryos that advanced into the blastocyst stage. These first results could allow the identification of embryos with improved viability and give better understanding of the development of pre-implantation embryo

193 Improved post-thaw survival of bovine embryos produced in serum-free In-vitro production system

Over a few decades the bovine in vitro embryo production (IVP) systems have been improving rapidly. Still, the goal to produce the same quality embryos in vitro as in vivo has not yet been reached. The FCS is usually added to media during IVP to provide growth factors and energy sources. Currently, serum-free culture systems are often preferred due to the lower risk of contamination and prevention of the development of large offspring syndrome. The aim of this study was to establish whether complete elimination of FCS from the bovine IVP system has an effect on blastocyst rates, embryo quality, and embryo survival rates after slow freezing. We replaced our conventional in vitro maturation (IVM) medium [tissue culture medium-199, 10% (v/v) FCS, 10 µg mL–1 epidermal growth factor (EGF), 1500 U mL–1 serum gonadotropin and chorionic gonadotropin (PG600), Na-pyruvate 0.5 mM, gentamycin sulfate 50 µg mL–1 and l-glutamine 1 mM] with SOF (SOFaaci) supplemented with 0.4% fatty acid-free BSA fraction V, 10 µg mL–1 EGF, and 1500 U mL–1 PG600. Matured cumulus-oocyte complexes (COC) from both experimental groups (total of 1145 from serum-free IVP and 687 from our conventional IVP system) were used for in vitro fertilisation and culture. Blastocyst rates were similar in the serum-free and our usual IVP protocol, 18 and 22%, respectively. Seventy-seven Grade 1 (according to IETS) Day 7 blastocysts from the serum-free IVP system and 80 Grade 1 Day 7 blastocysts from our conventional IVP system were frozen in 1.5 M ethylene glycol and 0.1 M sucrose containing cryopreservation medium. The post-thaw survival rates after 24 h of culture and evaluated as percentages of re-expanded embryos were 63.6% for the serum-free IVP and 46.3% for the conventional IVP system (P < 0.05, Z Test for 2 population proportions). These results indicate that it is possible to have a completely serum-free bovine IVP system and based on the slow freezing and thawing results the quality of serum-free IVP embryos might be better than of the embryos matured in our conventional maturation media. However, more experiments and increased sample sizes are needed to confirm the results

LSTM-CNN: An efficient diagnostic network for Parkinson's disease utilizing dynamic handwriting analysis.

BACKGROUND AND OBJECTIVES: Dynamic handwriting analysis, due to its noninvasive and readily accessible nature, has emerged as a vital adjunctive method for the early diagnosis of Parkinson's disease (PD). An essential step involves analysing subtle variations in signals to quantify PD dysgraphia. Although previous studies have explored extracting features from the overall signal, they may ignore the potential importance of local signal segments. In this study, we propose a lightweight network architecture to analyse dynamic handwriting signal segments of patients and present visual diagnostic results, providing an efficient diagnostic method. METHODS: To analyse subtle variations in handwriting, we investigate time-dependent patterns in local representation of handwriting signals. Specifically, we segment the handwriting signal into fixed-length sequential segments and design a compact one-dimensional (1D) hybrid network to extract discriminative temporal features for classifying each local segment. Finally, the category of the handwriting signal is fully diagnosed through a majority voting scheme. RESULTS: The proposed method achieves impressive diagnostic performance on the new DraWritePD dataset (with an accuracy of 96.2%, sensitivity of 94.5% and specificity of 97.3%) and the well-established PaHaW dataset (with an accuracy of 90.7%, sensitivity of 94.3% and specificity of 87.5%). Moreover, the network architecture stands out for its excellent lightweight design, occupying a mere 0.084M parameters, with only 0.59M floating-point operations. It also exhibits nearly real-time CPU inference performance, with the inference time for a single handwriting signal ranging from 0.106 to 0.220 s. CONCLUSIONS: We present a series of experiments with extensive analysis, which systematically demonstrate the effectiveness and efficiency of the proposed method in quantifying dysgraphia for a precise diagnosis of PD