Spermatozoa induce transcriptomic alterations in bovine oviductal epithelial cells prior to initial contact

The capability of spermatozoa to directly influence maternal gene expression is already established. Indeed, some of the changes induced by spermatozoa may have a direct functional importance in the pre-conceptional period. Although the mechanisms underlying these sperm-maternal interactions are not well characterized, it is possible that they could involve ligands that are released from the spermatozoa. This study therefore aimed to test whether physical contact between bovine spermatozoa and bovine oviductal epithelial cells (BOECs) is a prerequisite for spermatozoa-induced gene expression changes. We used two co-culture models: a contact co-culture model in which spermatozoa interact directly with BOECs, and a non-contact co-culture model in which an insert with the pore size of 0.4 μm was placed between spermatozoa and BOECs. Messenger RNA sequencing analysis of BOECs by RNA-seq revealed ten differentially expressed genes in contact system and 108 differentially expressed genes in the non-contact system after 10 h of co-culture. Retinol metabolism pathway and ovarian steroidogenesis pathway were significantly enriched in the non-contact co-culture system. Q-PCR analysis revealed that transcriptional responses can be rapid, with increased expression of four genes (DHRS3, CYP1B1, PTGS2, and ATF3) detectable within just 90 min of co-incubation, but with expression levels highly dependent on the type of co-culture system. The findings from our study demonstrate that direct contact with spermatozoa is not necessary to induce changes in gene expression of oviductal epithelial cells, suggesting that spermatozoa may be able to signal to maternal tissues in advance of their arrival

36 transgenic somatic cell nuclear transfer blastocyst selection with embryo biopsying

Somatic cell nuclear transfer (SCNT) is, to date, the most used technology producing transgenic (TG) cattle. Depending on the gene construct and transfection method, transfection efficiency may differ greatly. Applying a more intense selection regime after transfection may obliterate the cells. An extended selection affects the passage number and leads to genotypic and phenotypic drift of the cells. We used the pBC1 Milk Expression Vector Kit (cat. no. K270-01, Invitrogen Corp., Carlsbad, CA, USA) to make the expression vector of human FSH (hFSH). For TG fibroblast cell line, the AmaxaTM NucleofectorTM Kit for Primary Fibroblasts (cat. no. VPI-1002, Lonza Grouop, Basel, Switzerland) was used. For TG fibroblast selection, G418 (neomycin) was used for 21 days with a final concentration of 400 µg mL−1. The final passage number of the cell line was 6. The primers included in the pBC1 Milk Expression Vector Kit-BCF (GATTGACAAGTAATACGCTGTTTCCTC) and BCR (CATCAGAAGTTAAACAGCACAGTTAG)-were used to control the insert. The transgenesis of the cell line was confirmed by sequencing the PCR product and analysing it with the BlastN and Bioedit software to make sure the fibroblast cell line was hFSH-positive. These cells were thereafter randomly used for SCNT as donor cells. All the SCNT embryos were cultured for 4 days in IVF Bioscience (Falmouth, United Kingdom) culture media and then biopsied. After aspirating 1 blastomere from the 6- to 8-cell-stage embryo, the biopsied embryos were further individually cultured until Day 7 and blastocyst formation was recorded. Genomic DNA from the biopsies was isolated and amplified with REPLI-g Single Cell Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The primers BCF and BCR were used to control the hFSH positivity of the embryos, and the PCR product was visualised on a 1% agarose gel. From 62 biopsied SCNT cloned embryos, 22 (35.48%) tested TG positive. The total blastocyst yield from biopsied embryos was 26 (41.93%), of which 12 (54.54%) were TG positive blastocysts and selected for transfer. Our hFSH TG fibroblast cell line demonstrated a low concentration of TG cells in its culture, despite the selection and verification methods applied. Based on the analysis of SCNT embryos, only 54.54% of the embryos developed were TG positive. The embryo biopsying technique enables us to use only TG-positive SCNT cloned embryos for transfer, therefore avoiding non-TG pregnancies

193 Improved post-thaw survival of bovine embryos produced in serum-free In-vitro production system

Over a few decades the bovine in vitro embryo production (IVP) systems have been improving rapidly. Still, the goal to produce the same quality embryos in vitro as in vivo has not yet been reached. The FCS is usually added to media during IVP to provide growth factors and energy sources. Currently, serum-free culture systems are often preferred due to the lower risk of contamination and prevention of the development of large offspring syndrome. The aim of this study was to establish whether complete elimination of FCS from the bovine IVP system has an effect on blastocyst rates, embryo quality, and embryo survival rates after slow freezing. We replaced our conventional in vitro maturation (IVM) medium [tissue culture medium-199, 10% (v/v) FCS, 10 µg mL–1 epidermal growth factor (EGF), 1500 U mL–1 serum gonadotropin and chorionic gonadotropin (PG600), Na-pyruvate 0.5 mM, gentamycin sulfate 50 µg mL–1 and l-glutamine 1 mM] with SOF (SOFaaci) supplemented with 0.4% fatty acid-free BSA fraction V, 10 µg mL–1 EGF, and 1500 U mL–1 PG600. Matured cumulus-oocyte complexes (COC) from both experimental groups (total of 1145 from serum-free IVP and 687 from our conventional IVP system) were used for in vitro fertilisation and culture. Blastocyst rates were similar in the serum-free and our usual IVP protocol, 18 and 22%, respectively. Seventy-seven Grade 1 (according to IETS) Day 7 blastocysts from the serum-free IVP system and 80 Grade 1 Day 7 blastocysts from our conventional IVP system were frozen in 1.5 M ethylene glycol and 0.1 M sucrose containing cryopreservation medium. The post-thaw survival rates after 24 h of culture and evaluated as percentages of re-expanded embryos were 63.6% for the serum-free IVP and 46.3% for the conventional IVP system (P < 0.05, Z Test for 2 population proportions). These results indicate that it is possible to have a completely serum-free bovine IVP system and based on the slow freezing and thawing results the quality of serum-free IVP embryos might be better than of the embryos matured in our conventional maturation media. However, more experiments and increased sample sizes are needed to confirm the results