Frequency of Disc Degeneration at Different Levels of Cervical Vertebrae in Adult Patients with Neck Pain on Magnetic Resonance Imaging

Background:Disc degeneration is terminology used for heterogeneous changes affecting the anatomy and physiology of the intervertebral disc. Disc degeneration alters the material properties of the intervertebral disc leading to an unfavorable distribution and transmission of stress to adjacent spinal structures.Objective:The aim of the study was to determine the frequency of disc degeneration at different level of cervical vertebrae in adult patients with neck pain on magnetic resonance imaging.Methodology:In this descriptive study 180 adult patients were included. All patients had been collected from DHQ hospital Gilgit and Ghurki Trust teaching hospital. After informed consent, data were collected through 1.5 tesla GE (closed bore) and 0.35 tesla Hitachi (open bore) MRI machines.Results:Findings show that among 180 adult patients, 136 presented with disc degeneration among which 81 were males and 55 were females. Among 81 males, 63 had disc degeneration at multiple levels while 18 had single disc degeneration. In females 35 patients showed multiple disc degeneration while 20 involved a single disc.Conclusion:It is concluded that disc degeneration is prevalent in males than females. Disc degeneration at multiple levels is higher than single disc degeneration in both genders. Keywords: Disc degeneration, magnetic resonance imaging, intervertebral disc. DOI: 10.7176/JHMN/71-02 Publication date: February 29th 202

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei

The 2022 dengue outbreak in Bangladesh: hypotheses for the late resurgence of cases and fatalities

Bangladesh reported the highest number of annual deaths (n = 281) related to dengue virus infection in 2022 since the virus reappeared in the country in 2000. Earlier studies showed that >92% of the annual cases occurred between the months of August and September. The 2022 outbreak is characterized by late onset of dengue cases with unusually higher deaths in colder months, that is, October-December. Here we present possible hypotheses and explanations for this late resurgence of dengue cases. First, in 2022, the rainfall started late in the season. Compared to the monthly average rainfall for September and October between 2003 and 2021, there was 137 mm of additional monthly rainfall recorded in September and October 2022. Furthermore, the year 2022 was relatively warmer with a 0.71°C increased temperature than the mean annual temperature of the past 20 yr. Second, a new dengue virus serotype, DENV-4, had recently reintroduced/reappeared in 2022 and become the dominant serotype in the country for a large naïve population. Third, the post-pandemic return of normalcy after 2 yr of nonpharmaceutical social measures facilitates extra mosquito breeding habitats, especially in construction sites. Community engagement and regular monitoring and destruction of Aedes mosquitoes' habitats should be prioritized to control dengue virus outbreaks in Bangladesh

Tracking development assistance for health and for COVID-19: a review of development assistance, government, out-of-pocket, and other private spending on health for 204 countries and territories, 1990-2050

Background The rapid spread of COVID-19 renewed the focus on how health systems across the globe are financed, especially during public health emergencies. Development assistance is an important source of health financing in many low-income countries, yet little is known about how much of this funding was disbursed for COVID-19. We aimed to put development assistance for health for COVID-19 in the context of broader trends in global health financing, and to estimate total health spending from 1995 to 2050 and development assistance for COVID-19 in 2020. Methods We estimated domestic health spending and development assistance for health to generate total health-sector spending estimates for 204 countries and territories. We leveraged data from the WHO Global Health Expenditure Database to produce estimates of domestic health spending. To generate estimates for development assistance for health, we relied on project-level disbursement data from the major international development agencies' online databases and annual financial statements and reports for information on income sources. To adjust our estimates for 2020 to include disbursements related to COVID-19, we extracted project data on commitments and disbursements from a broader set of databases (because not all of the data sources used to estimate the historical series extend to 2020), including the UN Office of Humanitarian Assistance Financial Tracking Service and the International Aid Transparency Initiative. We reported all the historic and future spending estimates in inflation-adjusted 2020 US$, 2020 US$ per capita, purchasing-power parity-adjusted US$per capita, and as a proportion of gross domestic product. We used various models to generate future health spending to 2050. Findings In 2019, health spending globally reached$8. 8 trillion (95% uncertainty interval UI] 8.7-8.8) or $1132 (1119-1143) per person. Spending on health varied within and across income groups and geographical regions. Of this total,$40.4 billion (0.5%, 95% UI 0.5-0.5) was development assistance for health provided to low-income and middle-income countries, which made up 24.6% (UI 24.0-25.1) of total spending in low-income countries. We estimate that $54.8 billion in development assistance for health was disbursed in 2020. Of this,$13.7 billion was targeted toward the COVID-19 health response. $12.3 billion was newly committed and$1.4 billion was repurposed from existing health projects. $3.1 billion (22.4$2.4 billion (17.9%) was for supply chain and logistics. Only $714.4 million (7.7$1519 (1448-1591) per person in 2050, although spending across countries is expected to remain varied. Interpretation Global health spending is expected to continue to grow, but remain unequally distributed between countries. We estimate that development organisations substantially increased the amount of development assistance for health provided in 2020. Continued efforts are needed to raise sufficient resources to mitigate the pandemic for the most vulnerable, and to help curtail the pandemic for all. Copyright (C) 2021 The Author(s). Published by Elsevier Ltd

Mortality from gastrointestinal congenital anomalies at 264 hospitals in 74 low-income, middle-income, and high-income countries: a multicentre, international, prospective cohort study

Summary Background Congenital anomalies are the fifth leading cause of mortality in children younger than 5 years globally. Many gastrointestinal congenital anomalies are fatal without timely access to neonatal surgical care, but few studies have been done on these conditions in low-income and middle-income countries (LMICs). We compared outcomes of the seven most common gastrointestinal congenital anomalies in low-income, middle-income, and high-income countries globally, and identified factors associated with mortality. Methods We did a multicentre, international prospective cohort study of patients younger than 16 years, presenting to hospital for the first time with oesophageal atresia, congenital diaphragmatic hernia, intestinal atresia, gastroschisis, exomphalos, anorectal malformation, and Hirschsprung’s disease. Recruitment was of consecutive patients for a minimum of 1 month between October, 2018, and April, 2019. We collected data on patient demographics, clinical status, interventions, and outcomes using the REDCap platform. Patients were followed up for 30 days after primary intervention, or 30 days after admission if they did not receive an intervention. The primary outcome was all-cause, in-hospital mortality for all conditions combined and each condition individually, stratified by country income status. We did a complete case analysis. Findings We included 3849 patients with 3975 study conditions (560 with oesophageal atresia, 448 with congenital diaphragmatic hernia, 681 with intestinal atresia, 453 with gastroschisis, 325 with exomphalos, 991 with anorectal malformation, and 517 with Hirschsprung’s disease) from 264 hospitals (89 in high-income countries, 166 in middleincome countries, and nine in low-income countries) in 74 countries. Of the 3849 patients, 2231 (58·0%) were male. Median gestational age at birth was 38 weeks (IQR 36–39) and median bodyweight at presentation was 2·8 kg (2·3–3·3). Mortality among all patients was 37 (39·8%) of 93 in low-income countries, 583 (20·4%) of 2860 in middle-income countries, and 50 (5·6%) of 896 in high-income countries (p<0·0001 between all country income groups). Gastroschisis had the greatest difference in mortality between country income strata (nine [90·0%] of ten in lowincome countries, 97 [31·9%] of 304 in middle-income countries, and two [1·4%] of 139 in high-income countries; p≤0·0001 between all country income groups). Factors significantly associated with higher mortality for all patients combined included country income status (low-income vs high-income countries, risk ratio 2·78 [95% CI 1·88–4·11], p<0·0001; middle-income vs high-income countries, 2·11 [1·59–2·79], p<0·0001), sepsis at presentation (1·20 [1·04–1·40], p=0·016), higher American Society of Anesthesiologists (ASA) score at primary intervention (ASA 4–5 vs ASA 1–2, 1·82 [1·40–2·35], p<0·0001; ASA 3 vs ASA 1–2, 1·58, [1·30–1·92], p<0·0001]), surgical safety checklist not used (1·39 [1·02–1·90], p=0·035), and ventilation or parenteral nutrition unavailable when needed (ventilation 1·96, [1·41–2·71], p=0·0001; parenteral nutrition 1·35, [1·05–1·74], p=0·018). Administration of parenteral nutrition (0·61, [0·47–0·79], p=0·0002) and use of a peripherally inserted central catheter (0·65 [0·50–0·86], p=0·0024) or percutaneous central line (0·69 [0·48–1·00], p=0·049) were associated with lower mortality. Interpretation Unacceptable differences in mortality exist for gastrointestinal congenital anomalies between lowincome, middle-income, and high-income countries. Improving access to quality neonatal surgical care in LMICs will be vital to achieve Sustainable Development Goal 3.2 of ending preventable deaths in neonates and children younger than 5 years by 2030

Global burden of 288 causes of death and life expectancy decomposition in 204 countries and territories and 811 subnational locations, 1990–2021: a systematic analysis for the Global Burden of Disease Study 2021

BACKGROUND Regular, detailed reporting on population health by underlying cause of death is fundamental for public health decision making. Cause-specific estimates of mortality and the subsequent effects on life expectancy worldwide are valuable metrics to gauge progress in reducing mortality rates. These estimates are particularly important following large-scale mortality spikes, such as the COVID-19 pandemic. When systematically analysed, mortality rates and life expectancy allow comparisons of the consequences of causes of death globally and over time, providing a nuanced understanding of the effect of these causes on global populations. METHODS The Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2021 cause-of-death analysis estimated mortality and years of life lost (YLLs) from 288 causes of death by age-sex-location-year in 204 countries and territories and 811 subnational locations for each year from 1990 until 2021. The analysis used 56 604 data sources, including data from vital registration and verbal autopsy as well as surveys, censuses, surveillance systems, and cancer registries, among others. As with previous GBD rounds, cause-specific death rates for most causes were estimated using the Cause of Death Ensemble model-a modelling tool developed for GBD to assess the out-of-sample predictive validity of different statistical models and covariate permutations and combine those results to produce cause-specific mortality estimates-with alternative strategies adapted to model causes with insufficient data, substantial changes in reporting over the study period, or unusual epidemiology. YLLs were computed as the product of the number of deaths for each cause-age-sex-location-year and the standard life expectancy at each age. As part of the modelling process, uncertainty intervals (UIs) were generated using the 2·5th and 97·5th percentiles from a 1000-draw distribution for each metric. We decomposed life expectancy by cause of death, location, and year to show cause-specific effects on life expectancy from 1990 to 2021. We also used the coefficient of variation and the fraction of population affected by 90% of deaths to highlight concentrations of mortality. Findings are reported in counts and age-standardised rates. Methodological improvements for cause-of-death estimates in GBD 2021 include the expansion of under-5-years age group to include four new age groups, enhanced methods to account for stochastic variation of sparse data, and the inclusion of COVID-19 and other pandemic-related mortality-which includes excess mortality associated with the pandemic, excluding COVID-19, lower respiratory infections, measles, malaria, and pertussis. For this analysis, 199 new country-years of vital registration cause-of-death data, 5 country-years of surveillance data, 21 country-years of verbal autopsy data, and 94 country-years of other data types were added to those used in previous GBD rounds. FINDINGS The leading causes of age-standardised deaths globally were the same in 2019 as they were in 1990; in descending order, these were, ischaemic heart disease, stroke, chronic obstructive pulmonary disease, and lower respiratory infections. In 2021, however, COVID-19 replaced stroke as the second-leading age-standardised cause of death, with 94·0 deaths (95% UI 89·2-100·0) per 100 000 population. The COVID-19 pandemic shifted the rankings of the leading five causes, lowering stroke to the third-leading and chronic obstructive pulmonary disease to the fourth-leading position. In 2021, the highest age-standardised death rates from COVID-19 occurred in sub-Saharan Africa (271·0 deaths [250·1-290·7] per 100 000 population) and Latin America and the Caribbean (195·4 deaths [182·1-211·4] per 100 000 population). The lowest age-standardised death rates from COVID-19 were in the high-income super-region (48·1 deaths [47·4-48·8] per 100 000 population) and southeast Asia, east Asia, and Oceania (23·2 deaths [16·3-37·2] per 100 000 population). Globally, life expectancy steadily improved between 1990 and 2019 for 18 of the 22 investigated causes. Decomposition of global and regional life expectancy showed the positive effect that reductions in deaths from enteric infections, lower respiratory infections, stroke, and neonatal deaths, among others have contributed to improved survival over the study period. However, a net reduction of 1·6 years occurred in global life expectancy between 2019 and 2021, primarily due to increased death rates from COVID-19 and other pandemic-related mortality. Life expectancy was highly variable between super-regions over the study period, with southeast Asia, east Asia, and Oceania gaining 8·3 years (6·7-9·9) overall, while having the smallest reduction in life expectancy due to COVID-19 (0·4 years). The largest reduction in life expectancy due to COVID-19 occurred in Latin America and the Caribbean (3·6 years). Additionally, 53 of the 288 causes of death were highly concentrated in locations with less than 50% of the global population as of 2021, and these causes of death became progressively more concentrated since 1990, when only 44 causes showed this pattern. The concentration phenomenon is discussed heuristically with respect to enteric and lower respiratory infections, malaria, HIV/AIDS, neonatal disorders, tuberculosis, and measles. INTERPRETATION Long-standing gains in life expectancy and reductions in many of the leading causes of death have been disrupted by the COVID-19 pandemic, the adverse effects of which were spread unevenly among populations. Despite the pandemic, there has been continued progress in combatting several notable causes of death, leading to improved global life expectancy over the study period. Each of the seven GBD super-regions showed an overall improvement from 1990 and 2021, obscuring the negative effect in the years of the pandemic. Additionally, our findings regarding regional variation in causes of death driving increases in life expectancy hold clear policy utility. Analyses of shifting mortality trends reveal that several causes, once widespread globally, are now increasingly concentrated geographically. These changes in mortality concentration, alongside further investigation of changing risks, interventions, and relevant policy, present an important opportunity to deepen our understanding of mortality-reduction strategies. Examining patterns in mortality concentration might reveal areas where successful public health interventions have been implemented. Translating these successes to locations where certain causes of death remain entrenched can inform policies that work to improve life expectancy for people everywhere. FUNDING Bill & Melinda Gates Foundation