Prion Protein Strain Diversity and Disease Pathology

The infectious agents, prions, are composed mainly of conformational isomers of the cellular prion protein (PrPc) in its abnormal accumulated scrapie forms (PrPSc). The distinct prion isolates or strains have been associated with different PrPSc prion protein conformations and patterns of glycosylation and are associated with disease progression and severity. In humans, sporadic Creutzfeldt-Jakob disease (sCJD) is the most common form and has been divided into six subtypes, based on PrPSc electrophoretic mobility and allelic variation at codon 129, among which sCJD MM1 and sCJD VV2 are the two most commonly occurring subtypes with known clinical manifestations. The strain-specific response of PrPSc suggests both the molecular classification and the pathogenesis of prion diseases along with posttranslational modification of PrP in humans and animals

Prion protein interactome: identifying novel targets in slowly and rapidly progressive forms of alzheimer's disease

Rapidly progressive Alzheimer's disease (rpAD) is a variant of AD distinguished by a rapid decline in cognition and short disease duration from onset to death. While attempts to identify rpAD based on biomarker profile classifications have been initiated, the mechanisms which contribute to the rapid decline and prion mimicking heterogeneity in clinical signs are still largely unknown. In this study, we characterized prion protein (PrP) expression, localization, and interactome in rpAD, slow progressive AD, and in non-dementia controls. PrP along with its interacting proteins were affinity purified with magnetic Dynabeads Protein-G, and were identified using Q-TOF-ESI/MS analysis. Our data demonstrated a significant 1.2-fold decrease in di-glycosylated PrP isoforms specifically in rpAD patients. Fifteen proteins appeared to interact with PrP and only two proteins3/4histone H2B-type1-B and zinc alpha-2 protein3/4were specifically bound with PrP isoform isolated from rpAD cases. Our data suggest distinct PrP involvement in association with the altered PrP interacting protein in rpAD, though the pathophysiological significance of these interactions remains to be established. Keywords: Aldolase A, Alzheimer's disease, co-immunofluorescence, co-immunoprecipitation, histone, myelin P2, peroxiredoxin 1, prion, proteomics, synapsin, tubulin, zin

Prion protein oligomers cause neuronal cytoskeletal damage in rapidly progressive Alzheimer’s disease

Background: High-density oligomers of the prion protein (HDPs) have previously been identified in brain tissues of patients with rapidly progressive Alzheimer's disease (rpAD). The current investigation aims at identifying interacting partners of HDPs in the rpAD brains to unravel the pathological involvement of HDPs in the rapid progression. Methods: HDPs from the frontal cortex tissues of rpAD brains were isolated using sucrose density gradient centrifugation. Proteins interacting with HDPs were identified by co-immunoprecipitation coupled with mass spectrometry. Further verifications were carried out using proteomic tools, immunoblotting, and confocal laser scanning microscopy. Results: We identified rpAD-specific HDP-interactors, including the growth arrest specific 2-like 2 protein (G2L2). Intriguingly, rpAD-specific disturbances were found in the localization of G2L2 and its associated proteins i.e., the end binding protein 1, α-tubulin, and β-actin. Discussion: The results show the involvement of HDPs in the destabilization of the neuronal actin/tubulin infrastructure. We consider this disturbance to be a contributing factor for the rapid progression in rpAD

SFPQ and Tau: critical factors contributing to rapid progression of Alzheimer's disease

Dysfunctional RNA-binding proteins (RBPs) have been implicated in several neurodegenerative disorders. Recently, this paradigm of RBPs has been extended to pathophysiology of Alzheimer's disease (AD). Here, we identified disease subtype specific variations in the RNA-binding proteome (RBPome) of sporadic AD (spAD), rapidly progressive AD (rpAD), and sporadic Creutzfeldt Jakob disease (sCJD), as well as control cases using RNA pull-down assay in combination with proteomics. We show that one of these identified proteins, splicing factor proline and glutamine rich (SFPQ), is downregulated in the post-mortem brains of rapidly progressive AD patients, sCJD patients and 3xTg mice brain at terminal stage of the disease. In contrast, the expression of SFPQ was elevated at early stage of the disease in the 3xTg mice, and in vitro after oxidative stress stimuli. Strikingly, in rpAD patients' brains SFPQ showed a significant dislocation from the nucleus and cytoplasmic colocalization with TIA-1. Furthermore, in rpAD brain lesions, SFPQ and p-tau showed extranuclear colocalization. Of note, association between SFPQ and tau-oligomers in rpAD brains suggests a possible role of SFPQ in oligomerization and subsequent misfolding of tau protein. In line with the findings from the human brain, our in vitro study showed that SFPQ is recruited into TIA-1-positive stress granules (SGs) after oxidative stress induction, and colocalizes with tau/p-tau in these granules, providing a possible mechanism of SFPQ dislocation through pathological SGs. Furthermore, the expression of human tau in vitro induced significant downregulation of SFPQ, suggesting a causal role of tau in the downregulation of SFPQ. The findings from the current study indicate that the dysregulation and dislocation of SFPQ, the subsequent DNA-related anomalies and aberrant dynamics of SGs in association with pathological tau represents a critical pathway which contributes to rapid progression of AD

Molecular characterization of capsid protein gene of potato virus X from Pakistan

Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei

Cytoskeleton-associated risk modifiers involved in early and rapid progression of sporadic Creutzfeldt-Jakob disease

A high priority in the prion field is to identify pre-symptomatic events and associated profile of molecular changes. Inthisstudy,wedemonstratethepre-symptomatic dysregulation of cytoskeleton assembly and its associated cofilin-1 pathway in strain and brain region-specific manners in MM1 and VV2 subtype-specific Creutzfeldt-Jakob disease at clinical and pre-clinical stage. At physiological level, PrPC interaction with cofilin-1 and phosphorylated form of cofilin (p-cofilin(Ser3)) was investigated in primary cultures of mouse cortex neurons (PCNs) of PrPC wildtype and knockout mice (PrP−/−). Short-interfering RNA downregulation of active form of cofilin-1 resulted in the redistribution/downregulation of PrPC, increase of activated form of microglia, accumulation of dense form of Factin, and upregulation of p-cofilin(Ser3). This upregulated p-cofilin(Ser3) showed redistribution of expression predominantly in the activated form of microglia in PCNs. At pathological level, cofilin-1 expression was significantly altered in cortex and cerebellum in both humans and mice at pre-clinical stage and at early symptomatic clinical stage of the disease. Further, to better understand the possible mechanism of dysregulation of cofilin-1, we also demonstrated alterations in upstream regulators; LIM kinase isoform 1 (LIMK1), slingshot phosphatase isoform 1 (SSH1), RhoA-associated kinase (Rock2), and amyloid precursor protein (APP) in sporadic Creutzfeldt-Jakob disease MM1 mice and in human MM1 and VV2 frontal cortex and cerebellum samples. In conclusion, our findings demonstrated for the first time a key pre-clinical response of cofilin-1 and the associated pathway in prion disease

Food legume improvement in the People's Democratic Republic of Yemen

Meeting: Regional Food Legume Improvement and Development Workshop, 1st, 2-7 May 1978, Aleppo, SYIn IDL-579

Effect Of Supply Chain Risk Management On Organization Performance: A Case Study Of National Foods Manooabad Muridke District Sheikhupura

Purpose: Previously there are many studies that focused on risk management in general context and little attention was paid on how supply chain risks management affects an organization's profit and performance. The main aim of our study to explore the effect of supply chain risk management on organization performance in national foods Manooabad Muridke district Sheikhupura. Methodology: This study conducted in National foods Manooabad Muridke. Data were collected by using questioner from the employees of National foods Manooabad Muridke. SPSS 22 (Statistical package for social sciences) was used to analyze the collected data. Main Findings: This study is an attempt to check the effects of supply chain risk management variables to the performance of the organization. Three main supply chain risk management variables were identified namely, supply chain risk identification, supply chain risk sources and supply chain risk mitigation. We find that risk register method is mainly used for the identification of risks in the supply chain at any level. The most important risks of our study that are supplier risks, environmental risks, political risks, markets risks, warehousing risks, and financial risks. In mitigation strategies that are good to mitigate the risk in supply chain risk avoidance measures, risk control measures and risk cooperation measures. Applications: We concluded that it is important for an organization to identify risks proactively as early as possible in the decision-making process. Different types of risks need to be identified in all process of supply chains. After all the identification of risks, the organization needs to be mitigated these risks by using different mitigate strategies plan. Originality: In the future, this study will be helpful for many organizations which deal with food items consumed by people. As in this study, we worked on supply chain risks and their management before many studies were conducted generally on risk management so this study especially focused on supply chain risks. There is a need to conduct more study in this regard in different industries so better information available to people to control risks in supply chain management

Ligands binding to the prion protein induce its proteolytic release with therapeutic potential in neurodegenerative proteinopathies

The prion protein (PrPC) is a central player in neurodegenerative diseases, such as prion diseases or Alzheimer’s disease. In contrast to disease-promoting cell surface PrPC, extracellular fragments act neuroprotective by blocking neurotoxic disease-associated protein conformers. Fittingly, PrPC release by the metalloprotease ADAM10 represents a protective mechanism. We used biochemical, cell biological, morphological, and structural methods to investigate mechanisms stimulating this proteolytic shedding. Shed PrP negatively correlates with prion conversion and is markedly redistributed in murine brain in the presence of prion deposits or amyloid plaques, indicating a sequestrating activity. PrP-directed ligands cause structural changes in PrPC and increased shedding in cells and organotypic brain slice cultures. As an exception, some PrP-directed antibodies targeting repetitive epitopes do not cause shedding but surface clustering, endocytosis, and degradation of PrPC. Both mechanisms may contribute to beneficial actions described for PrP-directed ligands and pave the way for new therapeutic strategies against currently incurable neurodegenerative diseases