Development of a novel PCR based analytical protocol for the characterization of the two variants of prolactin gene that affect milk yield in sheep breeds

Prolactin is a lactogenic hormone which plays a significant role in milk production in mammals, and its depletion in sheep provokes severe reduction of milk secretion. Two different variants within intron 2 of the prolactin gene have been described (A and B) and this polymorphism has been recently proposed as a marker for future breeding schemes in dairy sheep. The present study fully characterized this polymorphism, resulting in a simpler and cost effective PCR-based assay for genetic identification in sheep populations. Up to now, the two variants A and B were identified by their difference in RFLP digestion patterns. This assay, however, is laborious since it requires the generation of a 2.5kb PCR fragment from genomic DNA prior to digestion, which is often difficult to obtain. By sequencing PCR products form AA and BB homozygous animals and performing alignments, we confirmed that the B variant results from a 23bp deletion (sequence: GGTGTTTCTCTTCATAAAGACTC) of the A variant of the prolactin gene. This finding assisted the design of new primers for the identification of prolactin polymorphism based on the size of the PCR product and relinquishes the need of RFLP digestions. Using these developments, we genotyped an experimental flock of 380 Chios breed sheep and carried out association studies. In contrast to other sheep breeds, such as the East Friesian and the Serra da Estela, our preliminary data showed no significant effect of this gene on Chios first lactation milk yield. However, the effects of the prolactin gene merit more investigation

Selection Signatures in Worldwide Sheep Populations

The diversity of populations in domestic species offers great opportunities to study genome response to selection. The recently published Sheep HapMap dataset is a great example of characterization of the world wide genetic diversity in sheep. In this study, we re-analyzed the Sheep HapMap dataset to identify selection signatures in worldwide sheep populations. Compared to previous analyses, we made use of statistical methods that (i) take account of the hierarchical structure of sheep populations, (ii) make use of linkage disequilibrium information and (iii) focus specifically on either recent or older selection signatures. We show that this allows pinpointing several new selection signatures in the sheep genome and distinguishing those related to modern breeding objectives and to earlier post-domestication constraints. The newly identified regions, together with the ones previously identified, reveal the extensive genome response to selection on morphology, color and adaptation to new environments

Genetic testing for TMEM154 mutations associated with lentivirus susceptibility in sheep

Stefan Hiendleder is a member of the International Sheep Genomics ConsortiumIn sheep, small ruminant lentiviruses cause an incurable, progressive, lymphoproliferative disease that affects millions of animals worldwide. Known as ovine progressive pneumonia virus (OPPV) in the U.S., and Visna/Maedi virus (VMV) elsewhere, these viruses reduce an animal’s health, productivity, and lifespan. Genetic variation in the ovine transmembrane protein 154 gene (TMEM154) has been previously associated with OPPV infection in U.S. sheep. Sheep with the ancestral TMEM154 haplotype encoding glutamate (E) at position 35, and either form of an N70I variant, were highly-susceptible compared to sheep homozygous for the K35 missense mutation. Our current overall aim was to characterize TMEM154 in sheep from around the world to develop an efficient genetic test for reduced susceptibility. The average frequency of TMEM154 E35 among 74 breeds was 0.51 and indicated that highly-susceptible alleles were present in most breeds around the world. Analysis of whole genome sequences from an international panel of 75 sheep revealed more than 1,300 previously unreported polymorphisms in a 62 kb region containing TMEM154 and confirmed that the most susceptible haplotypes were distributed worldwide. Novel missense mutations were discovered in the signal peptide (A13V) and the extracellular domains (E31Q, I74F, and I102T) of TMEM154. A matrix-assisted laser desorption/ionization–time-of flight mass spectrometry (MALDI-TOF MS) assay was developed to detect these and six previously reported missense and two deletion mutations in TMEM154. In blinded trials, the call rate for the eight most common coding polymorphisms was 99.4% for 499 sheep tested and 96.0% of the animals were assigned paired TMEM154 haplotypes (i.e., diplotypes). The widespread distribution of highly-susceptible TMEM154 alleles suggests that genetic testing and selection may improve the health and productivity of infected flocks.Michael P. Heaton, Theodore S. Kalbfleisch, Dustin T. Petrik, Barry Simpson, James W. Kijas, Michael L. Clawson, Carol G. Chitko-McKown, Gregory P. Harhay, Kreg A. Leymaster, the International Sheep Genomics Consortiu

Development of a cost effective direct DNA sequencing method for rapid SNP detection and genotyping of candidate genes

The search for novel polymorphisms which can either have an impact on animal health, or be utilized for the identification of genotype/phenotype correlations is of paramount importance in the area of animal genetics and genomics. Although high throughput SNP detection and genomic selection tools are now available for production animals such as cattle and sheep (Matukumalli et al., 2009), these methods are very expensive mainly due to high instrumentation and operating costs and hence uneconomical for the evaluation of many regional breeds of sheep around the world. The candidate gene approach alone or in combination with data from genome wide association studies however requires DNA sequencing from at least twenty individual animals for SNP identification. Common direct DNA sequencing methodologies used for SNP identification within a gene first require the PCR amplification of the region of interest followed by electrophoresis and gel extraction prior to performing actual DNA sequencing, thereby increasing the processing costs and limiting the sample throughput rate. This study therefore aimed at the development of a rapid and cost effective direct sequenced based genotyping method that would not require gel extraction or PCR clean up kits prior to sequencing. To illustrate the effectiveness of the technique, we have analysed the entire coding region of the ovine prolactin gene consisting of 5 exons, including both the 5′ and 3′ UTR

Non-glandular hairs contribute to the chemical defence of leaves against phytopathogenic bacteria

Μεθανολικά εκχυλίσματα των μη αδενωδών τριχών της αποαξονικής επιφάνειας των φύλλων της ελιάς (Olea europaea) και της αριάς (Quercus ilex) παρεμποδίζουν την in vitro ανάπτυξη αποικιών ορισμένων φυτοπαθογόνων βακτηρίων. Κάτω από τις ίδιες πειραματικές συνθήκες παρατηρείται επίσης παρεμποδιστική δράση των εκχυλισμάτων επιεφυμενιδικών συστατικών των φύλλων των φυτών Ditrichia viscosa και Cistus sp. Και στις δύο περιπτώσεις έγινε προσπάθεια οι συγκεντρώσεις των εκχυλισμάτων που εφαρμόστηκαν να προσεγγίζουν την in vivo κατάσταση. Τα αποτελέσματα δείχνουν ότι το στρώμα των μη αδενωδών τριχών ορισμένων φύλλων, λόγω της ύπαρξης φαινολικών ουσιών, προσφέρει όχι μόνο μηχανική αλλά και χημική προστασία έναντι πιθανών προσβολών

Precocious female maturation in seacage populations of European Seabass (Dicentrarchus Labrax) in Cyprus

The potential for the release of fish from aquaculture through spawning in seacages has already been noted for species such as cod and gilthead seabream. Precocious maturation of European seabass females has been noted in harvested fish in Cyprus. This study aims at quantifying the number of precocious females found in a typical seacage. The results indicate that under certain circumstances, European seabass are capable of reaching maturation and spawning within the normal residency period of seacages (18 months). Females of all size classes (from 350-1300g) were found with mature eggs and thus considered capable of spawning

Establishment of a sequence-based typing system for BoLA-DRB3 exon 2

A rapid, high-resolution sequence-based typing (SBT) system for BoLA-DRB3 exon 2 was developed. Amplification of the entire exon was achieved by a fully nested PCR with locus-specific primers and sequencing was performed directly on the PCR product. Heterozygous sequence data were obtained by automated sequence analysis of both alleles. Forward and reverse sequence data were assembled to improve identification of all heterozygous positions. Specific software (Haplofinder, Roslin Institute Software, Roslin, UK) was designed for allele assignment. Fifty-four females from a Holstein-Charolais resource herd cross, their 12 sires and five unrelated Holstein animals were used to establish the method. In parallel, these animals were typed by DRB3 polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to confirm the results. Polymerase chain reaction-RFLP analysis defined 15 known types in the 71 animals, while SBT of the same animals showed 19 known alleles. Subsequently, 72 more animals from the same resource herd were typed by the established SBT method without PCR-RFLP typing. This SBT strategy and the Haplofinder software can be applied to the analysis of any polymorphic locus for which suitable locus-specific primers and allelic sequences are available