Reactivity of human and porcine natural interferon-alpha producing cells to immunostimulatory DNA

The interferon-α (IFN-α) inducing capacity of various forms of immunostimulatory DNA and the identity of the IFN-α producing cells (IPC) were studied in human and porcine leukocytes. The DNA vaccine vector pcDNA3 induced production of IFN-α in porcine peripheral blood mononuclear cells (PBMC), but only if used with the transfecting agent lipofectin. Unmethylated CpG dinucleotides in the plasmid were necessary for induction of IFN-α, but pcDNA3 retained this ability after mutation of the CpG-motifs (5’AACGTT 3’) in the ampicillin resistance gene. Lipofection and presence of an unmethylated CpG were also prerequisites for the ability of the double stranded (ds) phosphodiester oligodeoxyribonucleotide (ODN) H (5’ TTTTCAATTCGAAGATGAAT 3’) to activate production of IFN-α in human and porcine PBMC. Human, but not porcine, PBMC could still produce high levels of IFN-α in response to certain single stranded (ss) ODNs, devoid of unmethylated CpG dinucleotides. This indicates that there are species differences in the recognition of immunostimulatory DNA and that eukaryotic DNA sometimes can be interferogenic. Certain CpG-containing ODNs with flanking poly-G sequences were very potent inducers of IFN-α production in the absence of lipofectin, both as phosphorothioate/ phosphodiester chimeric ODNs or as phosphodiester ODNs. Addition of poly-G sequences to the phosphodiester ODN H clearly enhanced its activity, but did not replace the need for lipofectin. The natural IFN-α producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), were the only cells among human or porcine PBMC that produced IFN-α in response to immunostimulatory DNA. The human NIPC/PDC also produce IFN-α in response to apoptotic cells in combination with autoantibodies from patients with systemic lupus erythematosus (SLE). This activation was dependent on Fcγ-receptor type II (FcγRII), and the NIPC/PDC were shown to express FcγRIIa, but not the FcγRIIb/c isoforms. The FcγRIIa may also be inhibitory, because aggregated IgG that binds FcγR had a general inhibitory effect on IFN-α production induced by immunostimulatory DNA or herpes simplex virus. Elucidation of the mechanisms whereby NIPC/PDC are activated may result in more efficient vaccine adjuvants and also provide new targets aiming at inhibition of the pathologic activation of NIPC/PDC in autoimmune diseases

Sparse Partially Collapsed MCMC for Parallel Inference in Topic Models

Topic models, and more specifically the class of Latent Dirichlet Allocation (LDA), are widely used for probabilistic modeling of text. MCMC sampling from the posterior distribution is typically performed using a collapsed Gibbs sampler. We propose a parallel sparse partially collapsed Gibbs sampler and compare its speed and efficiency to state-of-the-art samplers for topic models on five well-known text corpora of differing sizes and properties. In particular, we propose and compare two different strategies for sampling the parameter block with latent topic indicators. The experiments show that the increase in statistical inefficiency from only partial collapsing is smaller than commonly assumed, and can be more than compensated by the speedup from parallelization and sparsity on larger corpora. We also prove that the partially collapsed samplers scale well with the size of the corpus. The proposed algorithm is fast, efficient, exact, and can be used in more modeling situations than the ordinary collapsed sampler.Comment: Accepted for publication in Journal of Computational and Graphical Statistic

Carbide precipitation in a low alloyed steel during aging studied by atom probe tomography and thermodynamic modeling

Carbide precipitation in martensitic low alloyed steels contributes to the mechanical properties through precipitation hardening. A high number density of carbides is desired to maximize the hardening effect, which is achieved through the precipitation of carbides on the dislocations in the martensitic structure. In this study, the nucleation, growth, and coarsening of vanadium and molybdenum carbides during aging at 600◦C for periods up to four weeks were investigated. The work covers characterization with atom probe tomography, which showed that the nucleation of V and Mo rich MC/M2C carbides takes place on dislocations. The growth of these carbides proceeds by the diffusion of elements to the dislocations, which has been modeled using Dictra software, confirming the rate of the reaction as well as the depletion of carbide formers in the matrix. For longer aging times, particle coarsening will decrease the number density of particles with a transition from dislocation-based carbides to separate rounded carbides

Prospects for laser-driven ion acceleration through controlled displacement of electrons by standing waves

During the interaction of intense femtosecond laser pulses with various targets, the natural mechanisms of laser energy transformation inherently lack temporal control and thus commonly do not provide opportunities for a controlled generation of a well-collimated, high-charge beam of ions with a given energy of particular interest. In an effort to alleviate this problem, it was recently proposed that the ions can be dragged by an electron bunch trapped in a controllably moving potential well formed by laser radiation. Such standing-wave acceleration (SWA) can be achieved through reflection of a chirped laser pulse from a mirror, which has been formulated as the concept of chirped-standing-wave acceleration (CSWA). Here we analyze general feasibility aspects of the SWA approach and demonstrate its reasonable robustness against field structure imperfections, such as those caused by misalignment, ellipticity and limited contrast. Using this we also identify prospects and limitations of the CSWA concept.Comment: 13 pages, 12 figure

Utveckling av offentligt chefskap med chefspolicy som verktyg: en studie av implementeringen av chefspolicyn på Länsstyrelsen Skåne

Den offentliga sektorn befinner sig i ständig förändring och rör sig ständigt närmare den privata sektorns sätt att leda och styra, något som påverkar hur Länsstyrelsen leder sitt arbete framåt. Länsstyrelsen Skåne har tagit fram och implementerat en chefspolicy för att tydliggöra vilka förväntningar och krav som ställs på cheferna i organisationen, i syfte att på ett hållbart sätt utveckla det befintliga chefskapet. Fenomenet som studien ämnar studera är chefskap och syftet är att beskriva variationen i chefernas uppfattning om chefspolicyn som verktyg i utvecklingen av chefskap samt synliggöra hur policyn kan integreras i det dagliga arbetet i ett långsiktigt perspektiv. Studien genomsyras av en fenomenografisk ansats och det empiriska materialet har inhämtats via kvalitativa intervjuer med fem chefer ur Länsstyrelsens chefsgrupp. Den empiriska redogörelsen är uppdelad i tre större teman som identifieras i chefernas uppfattning; chef idag, organisatoriska förutsättningar och chefspolicy, där alla är relaterade till arbetet med chefspolicyn. För att få chefspolicyn att genomsyra det dagliga arbetet för cheferna bör organisationen arbeta aktivt med att integrera chefspolicyn i utvecklingssamtal och feedback, utvecklingsinsatser samt ge cheferna tid till reflektion. Om detta ska bli framgångsrikt bör organisationen formulera och kommunicera tydliga visioner och mål för hur cheferna på Länsstyrelsen ska bli morgondagens chefer

Evolution of iron carbides during tempering of low-alloy tool steel studied with polarized small angle neutron scattering, electron microscopy and atom probe

The magnetic scattering of iron carbides in low-alloy tool steel was investigated ex-situ by polarized small angle neutron scattering measurements after tempering the steel at 550 \ub0C and 600 \ub0C. Magnetic features could be detected in the as-quenched sample resulting in a negative interference term, believed to be either θ-Fe3C, η-Fe2C, or ε-Fe2-3C. During tempering the evolution of cementite could be studied by the variation of the interference term and in γ-ratio, which is the ratio of the magnetic to nuclear scattering length density contrast. From scanning transmission electron microscopy (STEM) and atom probe tomography, it is evident that cementite (θ-Fe3C) is present directly when reaching the tempering temperature of either 550 \ub0C or 600 \ub0C. At longer tempering times, cementite gets enriched with substitutional elements like chromium and manganese, forming an enriched shell on the cementite particles. STEM and energy dispersive x-ray spectrometry show that the chemical composition of small cementite particles approaches that of Cr-rich M7C3 carbides after 24 h at 600 \ub0C. It is also seen that small non-magnetic particles precipitate during tempering and these correspond well with molybdenum and vanadium-rich carbides

Alternativa belöningsgrunder – En fallstudie av belöningssystem i forsknings- och utvecklingsavdelningar

För många av dagens kunskapsintensiva företag uppkommer det en problematik vid utformandet av belöningssystem. Detta då deras output inte kan kvantifieras med finansiella mått. Ett exempel på en verksamhet med detta problem är FoU-avdelningar. Vårt syfte med denna studie är således att beskriva och analysera hur belöningssystem utformas i FoU-avdelningar. Vår teoretiska referensram och sedermera analytiska underlag, baseras på en kombination utav Thompson & Stricklands och Cummings & Worleys teorier kring belöningssystem. Studien är av kvalitativ art då tre företags belöningssystem har undersökts, med avsikt att få djupare förståelse för problemet. Resultatet indikerar på att FoU-avdelningar använder sig av ytterst sofistikerade belöningssystem. Individuella mål sätts upp för varje anställd och en utvärdering sker i slutet av året, där denne graderas på ett antal punkter. Utvärderingen ligger sedan till grund för hur stor belöning den anställde erhåller

Online encoder-decoder anomaly detection using encoder-decoder architecture with novel self-configuring neural networks & pure linear genetic programming for embedded systems

Recent anomaly detection techniques focus on the use of neural networks and an encoder-decoder architecture. However, these techniques lead to trade offs if implemented in an embedded environment such as high heat management, power consumption and hardware costs. This paper presents two related new methods for anomaly detection within data sets gathered from an autonomous mini-vehicle with a CAN bus. The first method which to the best of our knowledge is the first use of encoder-decoder architecture for anomaly detection using linear genetic programming (LGP). Second method uses self-configuring neural network that is created using evolutionary algorithm paradigm learning both architecture and weights suitable for embedded systems. Both approaches have the following advantages: it is inexpensive regarding resource use, can be run on almost any embedded board due to linear register machine advantages in computation. The proposed methods are also faster by at least one order of magnitude, and it includes both inference and complete training

Carbide Precipitation during Processing of Two Low-Alloyed Martensitic Tool Steels with 0.11 and 0.17 V/Mo Ratios Studied by Neutron Scattering, Electron Microscopy and Atom Probe

Two industrially processed low-alloyed martensitic tool steel alloys with compositions Fe-0.3C-1.1Si-0.81Mn-1.5Cr-1.4Ni-1.1Mo-0.13V and Fe-0.3C-1.1Si-0.81Mn-1.4Cr-0.7Ni-0.8Mo-0.14V (wt.%) were characterized using small-angle neutron scattering (SANS), scanning electron microscopy (SEM), Scanning transmission electron microscopy (STEM), and atom probe tomography (APT). The combination of methods enables an understanding of the complex precipitation sequences that occur in these materials during the processing. Nb-rich primary carbides form at hot working, while Fe-rich auto-tempering carbides precipitate upon quenching, and cementite carbides grow during tempering when Mo-rich secondary carbides also nucleate and grow. The number density of Mo-rich carbides increases with tempering time, and after 24 h, it is two to three orders of magnitude higher than the Fe-rich carbides. A high number density of Mo-rich carbides is important to strengthen these low-alloyed tool steels through precipitation hardening. The results indicate that the Mo-rich secondary carbide precipitates are initially of MC character, whilst later they start to appear as M2C. This change of the secondary carbides is diffusion driven and is therefore mainly seen for longer tempering times at the higher tempering temperature of 600◦C