9 research outputs found
Molecular characterization of capsid protein gene of potato virus X from Pakistan
Potato (Solanum tuberosum L.) is one of the most economically important vegetable crops in Pakistan. Chlorotic thickness veins spots intermingled with a dark green area, mosaic and decrease in size of the leaves were observed in the Lahore during a survey in 2009. Reverse transcriptase polymerase chain reaction (RT-PCR) based detection conditions were optimized for potato virus X using specific primers 5’-GGCGCAACTCCTGCCACAGC -3’ and 5’- TTGTTGTTCCAGTGATACGA -3’. 613 bp amplicon of capsid protein (CP) gene was amplified, cloned and sequenced (Accession number HE577130). Comparisons as well as phylogenetic reconstructions of CP sequence with PVX sequences retrieved from Genebank showed that the Pakistani PVX isolates (HE577130) has close relationship with USSR isolate. This is the first report on the molecular characterization of full length PVX coat protein sequence infecting potato from Pakistan. Homology of the sequenced gene of PVX with reported genes in Gene Data Bank was observed within the range of 90 and 99.7%. Maximum homology was observed to be 99.7% with the gene (Genebank accession No. M38480 and M72416).Keywords: Potato virus X, capsid protei
تاریخ کی بازیافت اور نئی معنویت بحوالہ عبدالحلیم شرر
Novel is aspect of literature which covers all views of life. Also, it covers historical events and novels with this quality are more famous. Due to the reason, writers of English, Hindi and Urdu novels, focused on historical events. Abdul Haleem Sharar also focused on historical aspects in his novel and he wrote historical novel for the first time. After then, many novelists followed the specific line. Abdul Haleem Sharar also elaborated cultural and social life
ڈپٹی نذیر احمد کے اسم بامسمیٰ کردار
Molvi Nazeer Ahmed is one of the greatest Urdu Novelists. He was considered as a first Urdu Novelist. His novels bear mostly the themes of troubles, ignorance and unawareness prevailing in his era. He was anxious about education of Muslim women and their lot in general; their ignorance and other problems. He gave the idea of a prefect woman being a practical and well-educated and presented them as guides for juvenile girls. His unmatchable novel, Mirat-ul-Uroos (The bride's mirror) comprises such subjects that endorse the foundation of female literacy in Muslim and Indian society, and is recognized for giving birth to an entire genre of fictional works encouraging female education in Urdu. It was his art of characterization that placed his novels in front line of Urdu Novels. Most of his characters are charactonym that means giving the name of a fictional character in such a way that the given name itself reveals the personality of a character. The present study critically analyzes his adaption of technique of charactonym in his novels. Being a social and religious reformer, he used this technique to get the purpose of reformation. By presenting the personal and internal life of a character, he depicts the true picture of human nature
Mutant Gossypium universal stress protein-2 (GUSP-2) gene confers resistance to various abiotic stresses in E. coli BL-21 and CIM-496-Gossypium hirsutum
Gossypium arboreum is considered a rich source of stress-responsive genes and the EST database revealed that most of its genes are uncharacterized. The full-length Gossypium universal stress protein-2 (GUSP-2) gene (510 bp) was cloned in E. coli and Gossypium hirsutum, characterized and point mutated at three positions, 352-354, Lysine to proline (M1-usp-2) & 214-216, aspartic acid to serine (M2-usp-2) & 145-147, Lysine to Threonine (M3-usp-2) to study its role in abiotic stress tolerance. It was found that heterologous expression of one mutant (M1-usp-2) provided enhanced tolerance against salt and osmotic stresses, recombinant cells have higher growth up to 10-5dilution in spot assay as compared to cells expressing W-usp-2 (wild type GUSP-2), M2-usp-2 and M3-usp-2 genes. M1-usp-2 gene transcript profiling exhibited significant expression (8.7 fold) in CIM-496-Gossypium hirsutum transgenic plants and enhance drought tolerance. However, little tolerance against heat and cold stresses in bacterial cells was observed. The results from our study concluded that the activity of GUSP-2 was enhanced in M1-usp-2 but wipe out in M2-usp-2 and M3-usp-2 response remained almost parallel to W-usp-2. Further, it was predicted through in silico analysis that M1-usp-2, W-usp-2 and M3-usp-2 may be directly involved in stress tolerance or function as a signaling molecule to activate the stress adaptive mechanism. However, further investigation will be required to ascertain its role in the adaptive mechanism of stress tolerance.Peer reviewe
Estimation of Potential Soil Erosion and Sediment Yield: A Case Study of the Transboundary Chenab River Catchment
Near real-time estimation of soil loss from river catchments is crucial for minimizing environmental degradation of complex river basins. The Chenab river is one of the most complex river basins of the world and is facing severe soil loss due to extreme hydrometeorological conditions, unpredictable hydrologic response, and complex orography. Resultantly, huge soil erosion and sediment yield (SY) not only cause irreversible environmental degradation in the Chenab river catchment but also deteriorate the downstream water resources. In this study, potential soil erosion (PSE) is estimated from the transboundary Chenab river catchment using the Revised Universal Soil Loss Equation (RUSLE), coupled with remote sensing (RS) and geographic information system (GIS). Land Use of the European Space Agency (ESA), Climate Hazards Group InfraRed Precipitation with Station (CHIRPS) data, and world soil map of Food and Agriculture Organization (FAO)/The United Nations Educational, Scientific and Cultural Organization were incorporated into the study. The SY was estimated on monthly, quarterly, seasonal, and annual time-scales using sediment delivery ratio (SDR) estimated through the area, slope, and curve number (CN)-based approaches. The 30-year average PSE from the Chenab river catchment was estimated as 177.8, 61.5, 310.3, 39.5, 26.9, 47.1, and 99.1 tons/ha for annual, rabi, kharif, fall, winter, spring, and summer time scales, respectively. The 30-year average annual SY from the Chenab river catchment was estimated as 4.086, 6.163, and 7.502 million tons based on area, slope, and CN approaches. The time series trends analysis of SY indicated an increase of 0.0895, 0.1387, and 0.1698 million tons per year for area, slope, and CN-based approaches, respectively. It is recommended that the areas, except for slight erosion intensity, should be focused on framing strategies for control and mitigation of soil erosion in the Chenab river catchment.Water Resource