sHSPdb: a database for the analysis of small Heat Shock Proteins

Background small Heat Shock Proteins (sHSP) is a wide proteins family. SHSP are found in all kingdoms and they play critical roles in plant stress tolerance mechanisms (as well as in pathogenic microorganisms and are implicated in human diseases). Results sHSPdb (small Heat Shock Proteins database) is an integrated resource containing non-redundant, full-length and curated sequences of sHSP, classified on the basis of amino acids motifs and physico-chemical properties. sHSPdb gathers data about sHSP defined by various databases (Uniprot, PFAM, CDD, InterPro). It provides a browser interface for retrieving information from the whole database and a search interface using various criteria for retrieving a refined subset of entries. Physicochemical properties, amino acid composition and combinations are calculated for each entry. sHSPdb provides automatic statistical analysis of all sHSP properties. Among various possibilities, sHSPdb allows BLAST searches, alignment of selected sequences and submission of sequences. Conclusions sHSPdb is a new database containing information about sHSP from all kingdoms. sHSPdb provides a classification of sHSP, as well as tools and data for the analysis of the structure - function relationships of sHSP. Data are mainly related to various physico-chemical properties of the amino acids sequences of sHSP. sHSPdb is accessible at http://forge.info.univ-angers.fr/~gh/Shspdb/index.php

Comparison of Amino Acids Physico-Chemical Properties and Usage of Late Embryogenesis Abundant Proteins, Hydrophilins and WHy Domain

Late Embryogenesis Abundant proteins (LEAPs) comprise several diverse protein families and are mostly involved in stress tolerance. Most of LEAPs are intrinsically disordered and thus poorly functionally characterized. LEAPs have been classified and a large number of their physico-chemical properties have been statistically analyzed. LEAPs were previously proposed to be a subset of a very wide family of proteins called hydrophilins, while a domain called WHy (Water stress and Hypersensitive response) was found in LEAP class 8 (according to our previous classification). Since little is known about hydrophilins and WHy domain, the cross-analysis of their amino acids physico-chemical properties and amino acids usage together with those of LEAPs helps to describe some of their structural features and to make hypothesis about their function. Physico-chemical properties of hydrophilins and WHy domain strongly suggest their role in dehydration tolerance, probably by interacting with water and small polar molecules. The computational analysis reveals that LEAP class 8 and hydrophilins are distinct protein families and that not all LEAPs are a protein subset of hydrophilins family as proposed earlier. Hydrophilins seem related to LEAP class 2 (also called dehydrins) and to Heat Shock Proteins 12 (HSP12). Hydrophilins are likely unstructured proteins while WHy domain is structured. LEAP class 2, hydrophilins and WHy domain are thus proposed to share a common physiological role by interacting with water or other polar/charged small molecules, hence contributing to dehydration tolerance

Experimental Approach for Bacterial Strains Characterization

In plant biology, data acquisition is no longer necessarily a major problem but nevertheless the treatment and the use of these data are still difficult. In this work, we are particularly interested by the characterization of strains of phytopathogenic bacterias, which is an important issue in the study of plant diseases. We study and compare several methods computing the smallest possible characterizations. These experiments have allowed us to characterize specific strains and diagnosis tests have been produced and used

The bacterial strains characterization problem

The accurate characterization of collections of bacterial strains is a major scientific challenge, since bacteria are indeed responsible of significant plant diseases and thus subjected to official control procedures (e.g., in Europe, Directive 2000/29/EC). The development of diagnostic tests is therefore an important issue in order to routinely identify strains of these species

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Simple blood fibrosis tests reduce unnecessary referrals for specialized evaluations of liver fibrosis in NAFLD and ALD patients

BACKGROUND: Liver fibrosis evaluation is mandatory in non-alcoholic fatty liver disease (NAFLD) and alcoholic liver disease (ALD) to decide the patient management. Patients with these diseases are usually under the care of non-liver specialists who refer them to specialized centers where the most accurate fibrosis tests are available. We aimed to evaluate whether simple blood fibrosis tests available to all physicians help to reduce the rate of unnecessary referral of NAFLD and ALD patients without advanced fibrosis. METHODS: NAFLD and/or ALD patients newly referred to our center for a non-invasive evaluation of liver fibrosis were retrospectively included. The FibroMeter (FM, combination of blood markers and Fibroscan results) was defined as the reference test for specialized evaluation of liver fibrosis. A FM result <0.384 indicated the absence of advanced fibrosis and thus an "unnecessary referral". RESULTS: 558 patients were included (NAFLD: 283, ALD: 156, mixed NAFLD+ALD: 119). FM was <0.384 (unnecessary referral) in 58.8% of patients. FIB4 was <1.30 in 45.2% and eLIFT <8 in 47.7% of the patients. 84.9% of patients with FIB4 <1.30 and 85.3% of patients with eLIFT <8 had also FM <0.384. Therefore, using FIB4 or eLIFT as first-line evaluation of liver fibrosis decreased by three-fold the rate of unnecessary referral. The negative predictive value of FIB4 and eLIFT was >80% whatever the underlying cause of chronic liver disease. CONCLUSION: The use of eLIFT by non-liver specialists for NAFLD and ALD patients can improve the relevance of referrals for specialized evaluation of liver fibrosis

Multiscale Poincaré plot analysis of time series from laser speckle contrast imaging data

The monitoring of microvascular blood flow is of importance for research and clinical purposes because, for some pathologies as diabetes, the microcirculation may be affected long before organ dysfunctions are diagnosed. Laser speckle contrast imaging (LSCI) is gaining an increased interest to monitor microvascular blood flow (peripheral cardiovascular data). However, in spite of this and by opposition to central cardiovascular data as electrocardiograms, very few studies have been conducted on the analysis of LSCI through scales. We therefore propose to process LSCI data with a multiscale approach relying on Poincaré plots. For this purpose, we first study multiscale Poincaré (MSP) plots of simulated signals (synthetic white and 1/f noise time series). Then, MSP plots of LSCI time series recorded in 24 healthy volunteers are generated and analyzed. Furthermore, this analysis on real-life data is also conducted to study the role played by age on the results. Thus, the subjects were divided into two age groups: 13 young subjects (mean age = 23.8 ± 3.2 years old) and 11 elderly subjects (mean age = 56.9 ± 6.7 years old). Our results show properties that may reveal a weak fractal structure for LSCI data. Moreover, we find no statistical difference (p ≥ 0.05) for the descriptors of MSP plots between the two age groups. MSP plots may become a simple-to-implement visualization tool to provide new insights into biomedical data across scales

Predicting live birth, preterm and low birth weight infant after in-vitro fertilisation: a prospective study of 144018 treatment cycles

Background The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown. Methods and Findings We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF) cycles undertaken in the UK between 2003 and 2007 (n = 144,018). We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI) as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226), we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2–23.7). In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46–1.71) more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99–1.24); p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia increased with advancing maternal age and a history of previous live births. Infertility due to cervical problems was associated with increased odds of all three outcomes—preterm birth, low birth weight, and macrosomia. Conclusions Pending external validation, our results show that couple- and treatment-specific factors can be used to provide infertile couples with an accurate assessment of whether they have low or high risk of a successful outcome following IVF

Test diagnostique non invasif de morphométrie automatisée de l'histologie des polypes coliques

Test diagnostique non invasif de morphométrie automatisée de l’histologie des polypes colique